ID: 984856624

View in Genome Browser
Species Human (GRCh38)
Location 4:184201041-184201063
Sequence CTGTCGAAAGGGCTGATGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984856619_984856624 -1 Left 984856619 4:184201019-184201041 CCTTCTGGATCTTCTCTCCTTGC 0: 1
1: 0
2: 2
3: 35
4: 389
Right 984856624 4:184201041-184201063 CTGTCGAAAGGGCTGATGATGGG No data
984856613_984856624 22 Left 984856613 4:184200996-184201018 CCCACGCATCCTCCCATGATCTG 0: 1
1: 0
2: 2
3: 3
4: 81
Right 984856624 4:184201041-184201063 CTGTCGAAAGGGCTGATGATGGG No data
984856618_984856624 9 Left 984856618 4:184201009-184201031 CCATGATCTGCCTTCTGGATCTT 0: 1
1: 0
2: 0
3: 21
4: 336
Right 984856624 4:184201041-184201063 CTGTCGAAAGGGCTGATGATGGG No data
984856617_984856624 10 Left 984856617 4:184201008-184201030 CCCATGATCTGCCTTCTGGATCT 0: 1
1: 0
2: 2
3: 27
4: 345
Right 984856624 4:184201041-184201063 CTGTCGAAAGGGCTGATGATGGG No data
984856614_984856624 21 Left 984856614 4:184200997-184201019 CCACGCATCCTCCCATGATCTGC 0: 1
1: 0
2: 0
3: 14
4: 128
Right 984856624 4:184201041-184201063 CTGTCGAAAGGGCTGATGATGGG No data
984856616_984856624 13 Left 984856616 4:184201005-184201027 CCTCCCATGATCTGCCTTCTGGA 0: 1
1: 0
2: 0
3: 21
4: 218
Right 984856624 4:184201041-184201063 CTGTCGAAAGGGCTGATGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984856624 Original CRISPR CTGTCGAAAGGGCTGATGAT GGG Intronic
No off target data available for this crispr