ID: 984857065

View in Genome Browser
Species Human (GRCh38)
Location 4:184204488-184204510
Sequence CTGGTTCTGAATCATGTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 3, 3: 10, 4: 152}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984857057_984857065 24 Left 984857057 4:184204441-184204463 CCAGACCACTCGCACCTAGGCCT 0: 1
1: 0
2: 2
3: 3
4: 92
Right 984857065 4:184204488-184204510 CTGGTTCTGAATCATGTGCCTGG 0: 1
1: 0
2: 3
3: 10
4: 152
984857063_984857065 -6 Left 984857063 4:184204471-184204493 CCTCACAGTGTTCCACGCTGGTT 0: 1
1: 0
2: 6
3: 298
4: 10085
Right 984857065 4:184204488-184204510 CTGGTTCTGAATCATGTGCCTGG 0: 1
1: 0
2: 3
3: 10
4: 152
984857060_984857065 4 Left 984857060 4:184204461-184204483 CCTGAACCGTCCTCACAGTGTTC 0: 1
1: 0
2: 0
3: 2
4: 75
Right 984857065 4:184204488-184204510 CTGGTTCTGAATCATGTGCCTGG 0: 1
1: 0
2: 3
3: 10
4: 152
984857061_984857065 -2 Left 984857061 4:184204467-184204489 CCGTCCTCACAGTGTTCCACGCT 0: 1
1: 0
2: 0
3: 10
4: 133
Right 984857065 4:184204488-184204510 CTGGTTCTGAATCATGTGCCTGG 0: 1
1: 0
2: 3
3: 10
4: 152
984857059_984857065 10 Left 984857059 4:184204455-184204477 CCTAGGCCTGAACCGTCCTCACA 0: 1
1: 0
2: 1
3: 10
4: 156
Right 984857065 4:184204488-184204510 CTGGTTCTGAATCATGTGCCTGG 0: 1
1: 0
2: 3
3: 10
4: 152
984857058_984857065 19 Left 984857058 4:184204446-184204468 CCACTCGCACCTAGGCCTGAACC 0: 1
1: 0
2: 0
3: 7
4: 92
Right 984857065 4:184204488-184204510 CTGGTTCTGAATCATGTGCCTGG 0: 1
1: 0
2: 3
3: 10
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984857065 Original CRISPR CTGGTTCTGAATCATGTGCC TGG Intronic
900384402 1:2403030-2403052 CCGGTACTTAATCATGTGCTGGG - Exonic
900551869 1:3260537-3260559 CTGAGTCTCAAGCATGTGCCAGG - Intronic
900569517 1:3351470-3351492 CTGGTCCTGGAGCAGGTGCCTGG + Intronic
906323742 1:44831783-44831805 CAGCTTCTCAATCATCTGCCAGG + Exonic
907274743 1:53310968-53310990 CGGGCTCTGAAGCATGTGCAGGG - Intronic
911388720 1:97211416-97211438 CTGTTTCTTACTAATGTGCCTGG + Intronic
923525365 1:234768487-234768509 CTGGTTCTGCCCCATGTCCCAGG + Intergenic
1065490111 10:26274409-26274431 CTGGTTCTGAACCACATGCAAGG + Intronic
1066809884 10:39315797-39315819 CTGGTTTTGAAGCATCTGCAAGG - Intergenic
1067187462 10:44043088-44043110 CTGATTCTGTCTCCTGTGCCTGG + Intergenic
1067331454 10:45324980-45325002 CTTTTTCTTAATCATTTGCCTGG + Intergenic
1072633531 10:97163433-97163455 CTGGTTCTCCATCAGCTGCCTGG + Exonic
1074776510 10:116771525-116771547 CTGGGTCTGAATCATTTCCAGGG + Intergenic
1075887296 10:125912153-125912175 AAGGATCTGAATCAGGTGCCAGG - Intronic
1076617998 10:131769575-131769597 CAGGTTCCGGAGCATGTGCCAGG - Intergenic
1079332326 11:19544073-19544095 GTGGTTCTCAATACTGTGCCTGG + Intronic
1079576607 11:22011301-22011323 CTGGTTCTGATTCCAGAGCCAGG + Intergenic
1083679379 11:64344185-64344207 GTGGGTCTGAATCAGGTGCCTGG - Exonic
1085128216 11:74016511-74016533 CTTGTTCTGATTCCTGGGCCTGG - Intronic
1085450485 11:76629297-76629319 CTGGCTCTGTGTCCTGTGCCAGG + Intergenic
1089598762 11:119600049-119600071 GTGGTTATGAATCATGTGCCTGG + Intergenic
1100882182 12:99031252-99031274 TTAGTTCTAAATCATATGCCAGG + Intronic
1101061709 12:100979279-100979301 ATGGTTCTCAAACATGTGTCAGG + Intronic
1101368619 12:104102022-104102044 CTGAATCTGTATCCTGTGCCTGG - Exonic
1101878419 12:108610287-108610309 CTGATTCTCTACCATGTGCCAGG + Intergenic
1101910351 12:108856808-108856830 CTGGTTCTGAGACCTGTGGCCGG - Intronic
1102549259 12:113679302-113679324 CTGCTAGTGAATGATGTGCCTGG + Intergenic
1105068856 12:133221669-133221691 CTGGTGCGGAAGGATGTGCCAGG + Intronic
1110937975 13:81316998-81317020 CTGGTTAAGAATTATCTGCCAGG - Intergenic
1113057719 13:106287583-106287605 GTGGGTCTGAGTCATGAGCCTGG + Intergenic
1113413351 13:110109240-110109262 GTGTTTCTGAAGCCTGTGCCTGG - Intergenic
1119805169 14:77477677-77477699 CTGAGCCTGCATCATGTGCCTGG - Intronic
1119960656 14:78852448-78852470 CTGGTTCTAAGTCAGGTGTCTGG + Intronic
1120372858 14:83660260-83660282 CTGGTTTTCAATCATCAGCCAGG + Intergenic
1121589265 14:95088876-95088898 CAAGTTCAGAATCATGTGCTGGG + Exonic
1122057436 14:99112414-99112436 CTACTTCTGAATCATTTGACAGG - Intergenic
1124267157 15:28247046-28247068 CTCTTTCTGTATCATGTGACTGG + Intronic
1126414009 15:48399163-48399185 CTGCTTCTGAATCATGTAGGAGG - Intergenic
1127359419 15:58231876-58231898 CTGGTTTTGAATCCTGGTCCTGG - Intronic
1130696484 15:86136667-86136689 CTGGTTCTGTATCATTGGCATGG + Intergenic
1134611216 16:15609890-15609912 GTGGTTCTCAAACATGTTCCAGG + Intronic
1135245755 16:20855543-20855565 CTGCTTCTGATTCAGGTGCTGGG - Exonic
1135664829 16:24326906-24326928 CTGGTTCAGGATCAGGTGGCAGG - Intronic
1137251100 16:46741534-46741556 CTGCTGCTGTAACATGTGCCAGG - Intronic
1138134686 16:54511572-54511594 CTGGTTGTGAATCACTTGCAAGG + Intergenic
1138221705 16:55257023-55257045 CTGGTTCTAAATCATAAGCTGGG - Intergenic
1138312703 16:56041748-56041770 CTGATTCATAGTCATGTGCCTGG + Intergenic
1139367997 16:66445625-66445647 CTGATTCAGAATCCTCTGCCTGG - Intronic
1139679363 16:68549090-68549112 CTGGTTCTGAAGCATGACCCTGG - Intronic
1140747081 16:77989985-77990007 TGGGTCTTGAATCATGTGCCAGG + Intergenic
1146936161 17:36813860-36813882 CTGAGTCTTTATCATGTGCCAGG - Intergenic
1149504121 17:57179101-57179123 CTGGATATGAATCATTTGTCAGG + Intergenic
1149559785 17:57600417-57600439 CTGGTTCAATCTCATGTGCCTGG + Intronic
1151844892 17:76645817-76645839 CTGCTGCTGTAGCATGTGCCTGG + Intergenic
1156791539 18:40980822-40980844 CTGCTTCTCAACCAAGTGCCTGG + Intergenic
1160011419 18:75109463-75109485 CTGTCTCTGAATTATGTGCCTGG + Intergenic
1160679955 19:408017-408039 CTCGATCTGGATCACGTGCCGGG + Exonic
1161699129 19:5785375-5785397 CTGGATCCGCATCAGGTGCCTGG - Exonic
1164725918 19:30465546-30465568 CTGAGTCTGTATTATGTGCCAGG - Intronic
1165392705 19:35547596-35547618 CTGGTTCTGTCTCAGGAGCCAGG + Intergenic
1166244600 19:41516624-41516646 CTGGTTTTGGATCTGGTGCCTGG + Intergenic
1166399444 19:42467471-42467493 CTGGGTATGAATCATGTGAGGGG + Intergenic
1168471697 19:56645572-56645594 CAGGTTCTGAATCTTGTGCCTGG + Exonic
925217184 2:2107112-2107134 CTGCTTCTGAACTGTGTGCCAGG - Intronic
925596051 2:5556403-5556425 CTGCTTCTGAAGTATGTGCCAGG - Intergenic
931071585 2:58657557-58657579 GTAGTCCTGTATCATGTGCCAGG - Intergenic
931218103 2:60264770-60264792 CGAGTTCTGGACCATGTGCCAGG + Intergenic
931550539 2:63440995-63441017 TCTTTTCTGAATCATGTGCCTGG - Intronic
932302711 2:70678438-70678460 CTGGTTCTGGGTCATGTGCCTGG + Intronic
932746021 2:74334120-74334142 CTGTTTCTGAACCATGTCCAGGG + Exonic
935483892 2:103628981-103629003 CTGGTTCTAAGTCCTGTTCCAGG + Intergenic
937198471 2:120180924-120180946 CTGATTCTTAATCTTGTTCCAGG + Intergenic
938341055 2:130536853-130536875 CTGCTTCTGATGCCTGTGCCAGG + Intergenic
938348775 2:130583856-130583878 CTGCTTCTGATGCCTGTGCCAGG - Intronic
938736494 2:134191104-134191126 CTTTTTCTGTATTATGTGCCTGG + Intronic
942328680 2:174798155-174798177 CTGGCTCTGAAGAATGTGCTTGG - Intergenic
942616005 2:177793019-177793041 CTGGTTCTTTATCATTTTCCAGG - Intronic
944578203 2:201110324-201110346 CTGTCTCTGAATAATATGCCTGG - Intergenic
944777906 2:202987765-202987787 CAGGGTGTGAATCATGTACCAGG + Intronic
945127813 2:206532203-206532225 CAGATGCTGAATCATGAGCCTGG + Intronic
946142098 2:217700188-217700210 CTTGTTCTGTATCTTGTGCCAGG - Intronic
946159333 2:217826568-217826590 CTGGTTCTGAACACTGGGCCTGG - Intronic
1171002947 20:21433306-21433328 CTGGTGCTGAGCCATGTGCATGG - Intergenic
1172352623 20:34255265-34255287 CTCGTTCTCAATCCTGTTCCTGG + Intronic
1173836478 20:46129196-46129218 CTGTTTCTGCATCCAGTGCCAGG - Exonic
1174354335 20:49988219-49988241 CTGGTTCTGTGTCCTCTGCCTGG + Exonic
1179856600 21:44165403-44165425 CTGGCTCTGAATGGGGTGCCGGG - Intergenic
1180717320 22:17880691-17880713 CTGCTCCTGAATGCTGTGCCTGG + Intronic
1181396947 22:22629574-22629596 CTGATTCTGAACCATGGGACTGG + Intergenic
1181499693 22:23308933-23308955 CTGATTCTGAACCATGGGACTGG + Intronic
1183316193 22:37138105-37138127 CAGCTACTGAATCAAGTGCCAGG - Intronic
949525894 3:4903175-4903197 TTGGTTTTGAATCCTTTGCCTGG + Intergenic
950838995 3:15948751-15948773 CTGGTTATGAAACATGTGTCTGG - Intergenic
951978350 3:28539613-28539635 CTGGTTGTGCATAATGTCCCTGG + Intergenic
952198237 3:31098360-31098382 GTTGTGCTGGATCATGTGCCAGG - Intergenic
953380049 3:42463159-42463181 TTGGATCTGAATCTTGTGTCTGG - Intergenic
954382072 3:50224831-50224853 CTGGTTCTGCCTCATCTTCCAGG - Intergenic
954672170 3:52297053-52297075 CTGGGTCTGGGTCATGTGCGAGG + Intergenic
954682993 3:52355899-52355921 CTGCCCCTGAATCATGGGCCCGG - Intronic
955689014 3:61572418-61572440 CTCGTTCTGGATCTTGTGTCTGG + Intronic
960057741 3:113287202-113287224 CTCGTGATGAACCATGTGCCTGG - Exonic
962441078 3:135416617-135416639 CAGGTTCTGTACCATGTGTCAGG + Intergenic
965543786 3:169895209-169895231 CTGGTTTTGGTTCATGTGGCTGG + Intergenic
966421713 3:179740498-179740520 CTGGTTCAGAATCAGATCCCTGG + Intronic
966703712 3:182886692-182886714 CTGCTTCTGACTAATGTGGCAGG + Intronic
967059158 3:185856096-185856118 CTTGTTTTGAATCATATGCTTGG - Intergenic
967155959 3:186692427-186692449 CTGCCTCTGAATCATGTCCAGGG + Intergenic
967598509 3:191356485-191356507 CTAGTTCTAACTCATGTCCCTGG + Intronic
968752923 4:2399553-2399575 CTGGGTATGTATGATGTGCCAGG - Intronic
970362039 4:15319745-15319767 CTGGTTGTTAAGCATGTACCAGG + Intergenic
976422352 4:84860454-84860476 TTCCTTCTGAGTCATGTGCCGGG + Exonic
978382503 4:108144330-108144352 CTGTTTCTTTAGCATGTGCCTGG - Intronic
981559063 4:146027090-146027112 ATGGGTCTGAATCTGGTGCCAGG + Intergenic
983384456 4:167041041-167041063 CTGTCTCTGAATCATGAGCAAGG - Intronic
983898531 4:173107329-173107351 CTAGTACATAATCATGTGCCTGG + Intergenic
984857065 4:184204488-184204510 CTGGTTCTGAATCATGTGCCTGG + Intronic
985952878 5:3236830-3236852 CTGGCCCTGAATCACCTGCCTGG - Intergenic
989060942 5:37411022-37411044 CTTTTTCTGATTCATTTGCCAGG - Intronic
990894975 5:60689131-60689153 TTAGTTCTCAACCATGTGCCAGG - Intronic
990960240 5:61386263-61386285 CTGCTTCTGAGTTATTTGCCCGG + Intronic
991662350 5:68962816-68962838 CTGGTTCTGGATCAAGTCACAGG + Intergenic
992218031 5:74544830-74544852 CAGGCTCTGCAGCATGTGCCTGG - Intergenic
992971884 5:82069503-82069525 GTGGTTCTGAACCCTGTGACTGG + Intronic
994644301 5:102450232-102450254 CTGGTTCTTACTCATGTGTGTGG + Intronic
997104073 5:130998011-130998033 CTGGTTTTGAATCACCTGGCAGG - Intergenic
1002554357 5:180023483-180023505 CTGGTGCTGTAAGATGTGCCAGG - Intronic
1005077097 6:21919120-21919142 CCTGTTCTGGATCATGTGCCAGG - Intergenic
1008405095 6:51110117-51110139 CTGGTTATGTACCATGTGCTAGG - Intergenic
1009938172 6:70257886-70257908 ATTCTTCTGAATCATGTGGCTGG - Intronic
1013249805 6:108322783-108322805 CTTGTTCTGAAAAATGTGCCAGG + Intronic
1014179821 6:118372560-118372582 ATGGCTCTGAGTCATCTGCCTGG + Intergenic
1014675001 6:124353355-124353377 CTGGTTCGGAATCATGAGGGAGG + Intronic
1016189983 6:141253099-141253121 CTGATTCTGAAATATGTTCCCGG - Intergenic
1016409183 6:143764203-143764225 CTGGTTCTAAATAATGTGAATGG - Intronic
1016439772 6:144070974-144070996 ATGGTTCTGAACCATTTACCAGG + Intergenic
1016895397 6:149046394-149046416 CTTGTTCTGGATCATCTGCTAGG + Intronic
1018417469 6:163613557-163613579 CTGCCTCTGAAGCGTGTGCCTGG + Intergenic
1022683132 7:32568816-32568838 CTGATTCTGAATGAGGAGCCTGG + Intronic
1022703627 7:32783683-32783705 CTGTTTCTGAAGCCTGTTCCTGG - Intergenic
1022907869 7:34873812-34873834 CTGTTTCTGAAGCCTGTTCCTGG - Intronic
1023602991 7:41898886-41898908 CTGGTTCTGAAGCATCAGCATGG + Intergenic
1024322023 7:48080009-48080031 CTGGTTCTGATCCATGGTCCAGG - Intergenic
1024990915 7:55234102-55234124 CGGGTTGTGTATCATCTGCCAGG + Intronic
1028091357 7:86706705-86706727 CTAGTTCAAGATCATGTGCCTGG - Intronic
1031202604 7:118708359-118708381 ATGCTTCTGAATCATGTGTCTGG - Intergenic
1033448162 7:141439846-141439868 CAGGATCTGAACCTTGTGCCTGG - Intronic
1035083644 7:156238029-156238051 CATGGTCTGAGTCATGTGCCTGG + Intergenic
1040727766 8:50403398-50403420 ATCATTCTGAATCATGGGCCTGG + Intronic
1043373439 8:79620455-79620477 TTTGTTCTGAAGCCTGTGCCAGG + Intronic
1047518154 8:125573292-125573314 CTGATTGTGAATCCTGTGCTAGG - Intergenic
1048274618 8:133056932-133056954 CAGGTTCTGATTCGTGGGCCTGG + Intronic
1048500250 8:134968840-134968862 CTGGCTCTGAATCCTTTCCCAGG + Intergenic
1048956728 8:139543605-139543627 CTGGTTCTGTAGCATGTACTAGG + Intergenic
1051338138 9:16085556-16085578 CTGGTTCCAAATCTTGTGCAAGG + Intergenic
1055262490 9:74454089-74454111 CTGGTTTTATATTATGTGCCAGG + Intergenic
1059288528 9:113199818-113199840 CTCTTTCAGAATCATGTGCTGGG - Exonic
1060912408 9:127361648-127361670 CTGTTTCTGAATCCTGGCCCTGG + Intronic
1186383699 X:9087871-9087893 CTGATTCTGAAAGAGGTGCCAGG - Intronic
1187477636 X:19626105-19626127 GTGGTTCAGAATCCTGTGCTGGG + Intronic
1192470464 X:71394457-71394479 CTGCCTCTGTATCAGGTGCCTGG + Intronic
1192863048 X:75098868-75098890 CTAGTTATGAATCCTGGGCCTGG - Intronic
1193022714 X:76808205-76808227 CTGGTTATTAATCACTTGCCAGG - Intergenic
1195500551 X:105593524-105593546 ATGGTTCTGTCTCATCTGCCTGG + Intronic
1198666215 X:139026020-139026042 CTAGTTCTGAATCCTGTGGCAGG - Intronic
1200247437 X:154533651-154533673 GTGGTTCTGCATCACGTCCCTGG + Exonic
1201584530 Y:15546252-15546274 CTGGTTCAGAGTCCTGAGCCAGG - Intergenic