ID: 984865127

View in Genome Browser
Species Human (GRCh38)
Location 4:184274638-184274660
Sequence CAGTATGCACAGATGGTGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984865127_984865133 24 Left 984865127 4:184274638-184274660 CCTTTCACCATCTGTGCATACTG No data
Right 984865133 4:184274685-184274707 CCCTTCTGAGCCCTACCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984865127 Original CRISPR CAGTATGCACAGATGGTGAA AGG (reversed) Intergenic
No off target data available for this crispr