ID: 984869247

View in Genome Browser
Species Human (GRCh38)
Location 4:184312016-184312038
Sequence GGTACCAAAGCACCACAGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984869247_984869248 -5 Left 984869247 4:184312016-184312038 CCTATCTGTGGTGCTTTGGTACC No data
Right 984869248 4:184312034-184312056 GTACCCTAGAAAACTAACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984869247 Original CRISPR GGTACCAAAGCACCACAGAT AGG (reversed) Intergenic
No off target data available for this crispr