ID: 984874071

View in Genome Browser
Species Human (GRCh38)
Location 4:184352025-184352047
Sequence GGTCTCACTGGACTAAAATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984874065_984874071 21 Left 984874065 4:184351981-184352003 CCAACTGTGTTATCCTACAGTCT No data
Right 984874071 4:184352025-184352047 GGTCTCACTGGACTAAAATCAGG No data
984874067_984874071 8 Left 984874067 4:184351994-184352016 CCTACAGTCTGAAGGTCAGAAGT No data
Right 984874071 4:184352025-184352047 GGTCTCACTGGACTAAAATCAGG No data
984874064_984874071 22 Left 984874064 4:184351980-184352002 CCCAACTGTGTTATCCTACAGTC No data
Right 984874071 4:184352025-184352047 GGTCTCACTGGACTAAAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984874071 Original CRISPR GGTCTCACTGGACTAAAATC AGG Intergenic
No off target data available for this crispr