ID: 984876002

View in Genome Browser
Species Human (GRCh38)
Location 4:184368130-184368152
Sequence CTGGACCCCTTCAATCATGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984875993_984876002 25 Left 984875993 4:184368082-184368104 CCCAAAATAAGCCGTATGTCAAA No data
Right 984876002 4:184368130-184368152 CTGGACCCCTTCAATCATGTAGG No data
984875994_984876002 24 Left 984875994 4:184368083-184368105 CCAAAATAAGCCGTATGTCAAAG No data
Right 984876002 4:184368130-184368152 CTGGACCCCTTCAATCATGTAGG No data
984875996_984876002 14 Left 984875996 4:184368093-184368115 CCGTATGTCAAAGTGGCATATTT 0: 4
1: 59
2: 100
3: 213
4: 351
Right 984876002 4:184368130-184368152 CTGGACCCCTTCAATCATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984876002 Original CRISPR CTGGACCCCTTCAATCATGT AGG Intergenic
No off target data available for this crispr