ID: 984877518

View in Genome Browser
Species Human (GRCh38)
Location 4:184382627-184382649
Sequence AACGTCGTTGGGAAGGCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984877518_984877524 27 Left 984877518 4:184382627-184382649 CCTCCAGCCTTCCCAACGACGTT No data
Right 984877524 4:184382677-184382699 GACTTTCTGCTTAAAATAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984877518 Original CRISPR AACGTCGTTGGGAAGGCTGG AGG (reversed) Intergenic
No off target data available for this crispr