ID: 984877980

View in Genome Browser
Species Human (GRCh38)
Location 4:184386322-184386344
Sequence CTTCTTCCCAACACAGACTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984877980_984877989 23 Left 984877980 4:184386322-184386344 CCTGAGTCTGTGTTGGGAAGAAG No data
Right 984877989 4:184386368-184386390 CCTTAAACCCTTTGATAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984877980 Original CRISPR CTTCTTCCCAACACAGACTC AGG (reversed) Intergenic
No off target data available for this crispr