ID: 984878036

View in Genome Browser
Species Human (GRCh38)
Location 4:184386738-184386760
Sequence CTGCAGCCACACATGGAGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984878031_984878036 27 Left 984878031 4:184386688-184386710 CCAGTTGATTTCCATTCAGGGCT No data
Right 984878036 4:184386738-184386760 CTGCAGCCACACATGGAGATAGG No data
984878033_984878036 16 Left 984878033 4:184386699-184386721 CCATTCAGGGCTGGATAACTTTA No data
Right 984878036 4:184386738-184386760 CTGCAGCCACACATGGAGATAGG No data
984878034_984878036 -10 Left 984878034 4:184386725-184386747 CCGCTAATTATATCTGCAGCCAC No data
Right 984878036 4:184386738-184386760 CTGCAGCCACACATGGAGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984878036 Original CRISPR CTGCAGCCACACATGGAGAT AGG Intergenic
No off target data available for this crispr