ID: 984878303

View in Genome Browser
Species Human (GRCh38)
Location 4:184388925-184388947
Sequence CCTCTTTGATGGTGACCTGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 189}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984878297_984878303 9 Left 984878297 4:184388893-184388915 CCAGGAGCTGTTGTAAGGCACCG 0: 1
1: 0
2: 0
3: 6
4: 87
Right 984878303 4:184388925-184388947 CCTCTTTGATGGTGACCTGGAGG 0: 1
1: 0
2: 3
3: 23
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984878303 Original CRISPR CCTCTTTGATGGTGACCTGG AGG Exonic
901636175 1:10671215-10671237 CCTGTTTGGCTGTGACCTGGGGG - Intronic
902732451 1:18378169-18378191 CGTCTTTGTTGGGGACCTGGAGG + Intronic
902954954 1:19919238-19919260 CTTCTTTGATGGGCCCCTGGGGG - Intergenic
905738769 1:40351136-40351158 CAGCTTTGATGGGGAGCTGGTGG + Intronic
906991603 1:50745526-50745548 CCTCTTTGATGCTGTTCTTGTGG + Intronic
910020805 1:82587249-82587271 CCTCTTTAATGGTCACTTGGGGG - Intergenic
912261017 1:108111636-108111658 CGACTTTGATGGTGCCATGGAGG - Intergenic
912462607 1:109846511-109846533 CCTGTTTGATGGTCACCAGGTGG - Intergenic
912605875 1:110987766-110987788 CATGTTTGATGGTGTCCTGTAGG - Intergenic
918225407 1:182476888-182476910 ACTCTTTAATGGAGACCTGAGGG - Intronic
920527820 1:206681155-206681177 CATCTTGGATGGTGAATTGGAGG - Intronic
920704517 1:208241955-208241977 TCTCCTTGGTGGTGGCCTGGAGG - Intronic
924434571 1:244027737-244027759 CCTCTTCGATTCTGACCTGTAGG + Intergenic
1063592285 10:7406957-7406979 ACTCTTTGGTGGGGACCTAGAGG + Intronic
1063733961 10:8731301-8731323 CCTGTTTTATGCTGCCCTGGGGG + Intergenic
1065589370 10:27250261-27250283 TGAGTTTGATGGTGACCTGGAGG + Intergenic
1067828645 10:49597417-49597439 CACCTCTGATGGGGACCTGGAGG - Intergenic
1070939758 10:80334177-80334199 CCTCTATGATGGTGCCCTTTGGG + Intergenic
1071256395 10:83875693-83875715 CCTATATGCTGGTGACCAGGTGG + Intergenic
1072426052 10:95331777-95331799 CCTGTTTGATGGTCACCAGGTGG - Intronic
1072955434 10:99884071-99884093 ACTTTTGGAAGGTGACCTGGTGG - Exonic
1073239614 10:102048000-102048022 CCTCTTTGATATTGACATGTTGG - Intronic
1074468286 10:113704422-113704444 TCTCTTTGTGGATGACCTGGAGG + Intronic
1075085396 10:119411182-119411204 CCTCTTTGGTGGTGACCATGAGG - Intronic
1075478859 10:122761647-122761669 CCTATTTGACGGTGACCTTCAGG + Intergenic
1075483521 10:122801546-122801568 CATCACTGATGGTCACCTGGGGG - Intergenic
1076648054 10:131967248-131967270 TAACTTTGATGGTGACCAGGGGG + Exonic
1077263540 11:1636675-1636697 CCTTGTTGGTGGTGACCTGGAGG - Intergenic
1077407821 11:2390589-2390611 CCTTTTGGATGGGGACATGGAGG + Intronic
1077886525 11:6391479-6391501 CCTCTTTGAGGATGACATGGTGG + Exonic
1079658046 11:23006152-23006174 CCTCTTTAATGCAGACCTGGAGG - Intergenic
1081736170 11:45405994-45406016 CCTCCATGATGGTGAACTGGAGG - Intergenic
1084207560 11:67604824-67604846 CCTCTTGGCTTGTGGCCTGGAGG + Exonic
1084807590 11:71589757-71589779 CCTCTTTGAAGGTCTCCAGGTGG + Intronic
1085570729 11:77555873-77555895 CCTCTTTGATGGTCACCAGGTGG - Intronic
1085670735 11:78462322-78462344 CCTTTTTGCTGGCAACCTGGGGG + Intronic
1087343463 11:96938373-96938395 CCTGTTGGACGGTGAGCTGGGGG - Intergenic
1087671380 11:101111372-101111394 ACTCTTTGATCGAGATCTGGGGG - Intronic
1089009624 11:115121918-115121940 CCACTTTGATGGTGGCCTGGAGG + Intergenic
1091356435 11:134941291-134941313 CCTCTCTGCTGCTGTCCTGGAGG + Intergenic
1091369847 11:135048764-135048786 CCTGTTTGATGGTCACCAGGGGG + Intergenic
1094737835 12:33255140-33255162 CCTGTTTGATGGTCACCAGGTGG + Intergenic
1096575897 12:52552750-52552772 TCTCATTGACGGTAACCTGGTGG + Exonic
1096585679 12:52618191-52618213 TCTTGTTGATGGTGACCTGATGG + Exonic
1098443672 12:70544617-70544639 GCTCTTTGATGAGGACCTGAAGG - Exonic
1099862573 12:88238738-88238760 CCTGCCTGAAGGTGACCTGGTGG + Intergenic
1100093940 12:91008175-91008197 CATCTATCATGGTGGCCTGGTGG + Intergenic
1101839435 12:108317153-108317175 CCTGTTTGGTGGTGGGCTGGAGG + Intronic
1101995961 12:109524990-109525012 GCCCTTTGATTGTGTCCTGGTGG + Intronic
1104490401 12:129189123-129189145 CCTCTCTCATGGGGACCTGAAGG - Intronic
1106845920 13:33737712-33737734 CCTGTTTGATGGTCACCAGGTGG - Intergenic
1108595697 13:51946678-51946700 CCTCTTTGAGGGAAACCTGTAGG - Intronic
1109157962 13:58935080-58935102 CCTGTTTGATAGTCACCAGGTGG + Intergenic
1115229177 14:31139876-31139898 CATTTTTTATGGTTACCTGGAGG + Exonic
1117282311 14:54253300-54253322 ACTCTTTGTTTGTGATCTGGAGG - Intergenic
1119420679 14:74506093-74506115 CCTCTGTGCCAGTGACCTGGAGG - Exonic
1119476174 14:74930850-74930872 CCTCTTTAATGCTGACCTTAGGG + Intergenic
1119714940 14:76852531-76852553 CCTCATTGATGGTGACCATGAGG - Intronic
1119805985 14:77482652-77482674 CCACCTTGATGGTCACCTGCAGG + Exonic
1121228480 14:92339287-92339309 CCTCTTTGATTTTGACATCGGGG - Intronic
1123018072 14:105384940-105384962 CCTCTGCGATGGGGAGCTGGTGG - Exonic
1127562305 15:60151546-60151568 CCTTCTTGATGGTGAGGTGGGGG - Intergenic
1128691340 15:69726851-69726873 CCCCTTTGCTGCTGGCCTGGGGG + Intergenic
1130329549 15:82910694-82910716 CGTGTTTGATGGTCACCAGGTGG + Intronic
1132131022 15:99279591-99279613 TCTCTTTGATTGTGAACTGTTGG + Intronic
1133712533 16:8415171-8415193 ACTCTTGGCTGTTGACCTGGGGG - Intergenic
1134772057 16:16817687-16817709 GCTCTTTGATGGTGAGCAGAGGG - Intergenic
1136605325 16:31329884-31329906 CCTCGGAGAAGGTGACCTGGGGG - Exonic
1137676243 16:50305162-50305184 CCTGTTGTATGGTGCCCTGGCGG + Intronic
1140260767 16:73377333-73377355 CCTCCTTGATGGTCACATGTGGG - Intergenic
1140279676 16:73543422-73543444 CCCCTTTCCTTGTGACCTGGAGG + Intergenic
1141201983 16:81905231-81905253 CCTCGTTCAGGGTAACCTGGAGG + Intronic
1143096527 17:4481236-4481258 CATGTTTGAGGGTGAGCTGGGGG + Intronic
1143369451 17:6429366-6429388 TCTCTGTGCTGGTGACCTGGAGG - Intronic
1146062070 17:29612880-29612902 CCTCCCAGATGGTGACCTGCGGG - Exonic
1146985293 17:37210641-37210663 CCTCTTTGGAGGTATCCTGGGGG - Intronic
1147340894 17:39752736-39752758 TTTCTTTGATGGGCACCTGGGGG + Intergenic
1147719474 17:42529859-42529881 CCTGTTTGATGGTCAACAGGTGG - Intergenic
1148174078 17:45549128-45549150 TGAGTTTGATGGTGACCTGGAGG + Intergenic
1148275189 17:46296319-46296341 TGAGTTTGATGGTGACCTGGAGG - Exonic
1148297295 17:46513898-46513920 TGAGTTTGATGGTGACCTGGAGG - Exonic
1148361850 17:47018378-47018400 TGAGTTTGATGGTGACCTGGAGG - Intronic
1150213448 17:63454083-63454105 TCTCTCTGATGGTCAGCTGGCGG - Intergenic
1150405292 17:64896050-64896072 TGAGTTTGATGGTGACCTGGAGG + Exonic
1154498214 18:14978014-14978036 CCTCTCTGCTGCTGTCCTGGAGG - Intergenic
1156487619 18:37476624-37476646 CGTCTTTGTTGTTGACCTGCAGG - Intronic
1157911162 18:51618425-51618447 CCTACTTGATGGTCACCAGGTGG - Intergenic
1160453769 18:78981294-78981316 CCTCTTTCCTGGCGCCCTGGGGG - Intronic
1160600340 18:80007845-80007867 CCTGTTTGATGGTCACCAGGTGG + Intronic
1160860380 19:1235047-1235069 CCTCATTGAAGGAGACCCGGCGG + Exonic
1161655975 19:5515162-5515184 CCTGTCTGATGGTGTCCTGCTGG - Intergenic
1161796518 19:6389888-6389910 CCTGCTTGATGGTCACCAGGTGG - Intronic
1162319241 19:9960991-9961013 CCTCAGAGATGGTGACATGGGGG - Intronic
1167510956 19:49895165-49895187 CCTCCAGGATGGTGACCTGAGGG + Exonic
1168348579 19:55662608-55662630 CCTTTTTGGAGGTGAGCTGGGGG + Exonic
1168643519 19:58045371-58045393 TCTCCTGGATGGTGTCCTGGAGG - Intronic
925072376 2:980269-980291 CCTCTTTAAAGGTGAGCAGGTGG + Intronic
926734186 2:16060085-16060107 CCCCATTAATGGTGAGCTGGGGG - Intergenic
929919953 2:46164826-46164848 CCTCTGTGGTGGTGACCCAGGGG - Intronic
931462803 2:62462954-62462976 CCTCTTTCCTTGTGACCTTGTGG + Intergenic
933066621 2:77806244-77806266 CCTTTTTGATGGTCACCTGGTGG + Intergenic
933593548 2:84260097-84260119 CTTCTTTGATCTTGAGCTGGGGG - Intergenic
933982536 2:87564288-87564310 CATCTTTGGTGGTGATTTGGAGG - Intergenic
935455780 2:103266211-103266233 TATCTGTGATGGTGACATGGCGG + Intergenic
936012967 2:108936666-108936688 CTGCTCTGATGGTGACCTTGCGG - Intronic
936025835 2:109030582-109030604 CCTCTTTGAGGATGACCAGCAGG + Intergenic
936311305 2:111386504-111386526 CATCTTTGGTGGTGATTTGGAGG + Intergenic
936469040 2:112781628-112781650 CATCACTGATGATGACCTGGAGG - Exonic
939422147 2:141985359-141985381 CCTCTTTGATGGTAATGTGCTGG - Intronic
944131475 2:196352217-196352239 CCTCTTAGCAGGTGGCCTGGTGG - Intronic
945918616 2:215731360-215731382 CCTCTTTGCTGTTTCCCTGGTGG - Intergenic
945990564 2:216392360-216392382 CTGCTTTAATGGTGACCTGCTGG - Intergenic
946914358 2:224501701-224501723 ACTCTTAGATGGTGTACTGGGGG + Intronic
948907303 2:240986023-240986045 CCTCCCTGATGGGGACATGGTGG + Intronic
1169154329 20:3316631-3316653 CCTCTTTGTTGGGCCCCTGGTGG - Intronic
1170530657 20:17287927-17287949 GCTCTTTCAGGGTGAGCTGGGGG - Intronic
1172667251 20:36608883-36608905 CCTAATTGATGGTGAGCTGAGGG + Intronic
1172765431 20:37348274-37348296 CTTCTCTGATTGTGACCAGGGGG + Intronic
1175652736 20:60740726-60740748 CTTCTTTGATGGTGTCCTTGAGG + Intergenic
1176424292 21:6538463-6538485 CCCCTTTGATGAGGCCCTGGAGG + Intergenic
1177360157 21:20057815-20057837 CCTGTTTGATGGTCATCAGGTGG + Intergenic
1178928934 21:36800158-36800180 CCTCTTTGATGATGGAGTGGTGG - Intronic
1179699785 21:43146778-43146800 CCCCTTTGATGAGGCCCTGGAGG + Intergenic
1180577575 22:16793634-16793656 CCTATTTGATGGTCACCAGGTGG - Intronic
1181093295 22:20489046-20489068 CCTCTTCGATGTTGTGCTGGTGG - Exonic
1181925823 22:26357807-26357829 CCTCTTTGATAAGGACGTGGTGG + Intronic
1183540722 22:38427868-38427890 CTTCTTCCACGGTGACCTGGAGG - Exonic
1183713737 22:39521541-39521563 TCTCTTAGATGATTACCTGGAGG + Exonic
1185099563 22:48830391-48830413 CCCCTTTGAGGGGCACCTGGAGG - Intronic
950125864 3:10509453-10509475 GCTCTTTGAGGGTGATCTGTGGG - Intronic
952718275 3:36504508-36504530 CCACTTGGATGGTGACCTGCAGG - Intronic
953839453 3:46377360-46377382 CCTCTTTGATAGAGACCTCTGGG - Intergenic
954669632 3:52282612-52282634 CCTGTTGGATGGTTACCAGGTGG + Intronic
957044312 3:75362172-75362194 CCTCTTTGAAGGTCTCCAGGTGG - Intergenic
961278108 3:125743449-125743471 CCTCTTTGAAGGTCTCCAGGTGG + Intergenic
962831818 3:139148819-139148841 CCTTTTTCATACTGACCTGGAGG - Intronic
964066200 3:152582979-152583001 CCTCTTTGATGGTGTGCTGCTGG - Intergenic
966721750 3:183070356-183070378 TCTTTTTGTTGGTGACCTAGCGG - Intronic
966787910 3:183636732-183636754 CCCCCTTGAAGGTGATCTGGAGG + Intronic
968668545 4:1834910-1834932 TCTCCTCGATGGTGTCCTGGAGG + Exonic
968928885 4:3565671-3565693 CCCCTTTGGCTGTGACCTGGGGG - Intergenic
970652844 4:18197660-18197682 CCTGTGTGATTGTGACCTGGTGG + Intergenic
970998190 4:22291945-22291967 CCTCTCTGAAGTTGTCCTGGTGG + Intergenic
973982418 4:56317165-56317187 TCTGTTTGATGGTCACCAGGTGG + Intronic
975870869 4:78776687-78776709 ACTCTTCCAGGGTGACCTGGTGG - Exonic
976285917 4:83371000-83371022 CCTCTTTGCTGCTGCCCTGAAGG - Intergenic
980128775 4:128799131-128799153 CCTGTTTGATAGTCACCAGGTGG + Intergenic
983233699 4:165155503-165155525 CCTGTTTGATGGTTACCAGGTGG - Intronic
984878303 4:184388925-184388947 CCTCTTTGATGGTGACCTGGAGG + Exonic
986929116 5:12795740-12795762 CCTCTGTGATGGGGCTCTGGGGG - Intergenic
988496755 5:31751849-31751871 CCTCTTTGAAGCTGGGCTGGGGG + Intronic
989111032 5:37906847-37906869 GCTCCTTGGTGGTGTCCTGGGGG + Intergenic
991443574 5:66676977-66676999 CCTTTTTGAAGGTCATCTGGTGG + Intronic
992610472 5:78504251-78504273 CCTCTTTGAGGGTGTTCTGAAGG + Intronic
994088529 5:95786475-95786497 CCTCCTTGATGGAAACCTGAAGG - Intronic
995833139 5:116375538-116375560 CCTCTAGGATGATGACCTTGAGG - Intronic
997878025 5:137566260-137566282 CCTCTGTGTGGGTGTCCTGGAGG - Intronic
997930308 5:138067324-138067346 CCTGTTTGATGGTCACCAGGTGG - Intergenic
1001032355 5:168272106-168272128 CCGCTTTGATGGGGATTTGGTGG + Intergenic
1001072630 5:168600198-168600220 CCTGTTTGATAGTCACCAGGTGG + Intergenic
1001109432 5:168883584-168883606 CCTCTTGGCTCGTGGCCTGGAGG - Intronic
1001938609 5:175725276-175725298 CCTGTTCGATGGTCACCAGGTGG + Intergenic
1002184153 5:177446597-177446619 CCCCTGTGAGGGTGCCCTGGCGG + Intronic
1003939910 6:11014242-11014264 TCTCTTGGATGGATACCTGGGGG - Intronic
1005194269 6:23264863-23264885 CCTGTTTGATTGTCACCAGGCGG - Intergenic
1008602861 6:53112634-53112656 GCTCTTTGAGAGTGCCCTGGAGG - Intergenic
1010010286 6:71040864-71040886 TCTGTTTGATGGTCACCAGGTGG + Intergenic
1010010297 6:71040936-71040958 TCTGTTTGATGGTCACCAGGTGG + Intergenic
1010024977 6:71204526-71204548 ACTCTCTGAGGGTGACCTGACGG - Intergenic
1011591767 6:88976749-88976771 CCTGTTTGATAGTCACCAGGTGG - Intergenic
1013429206 6:110040858-110040880 CCTGTTTGGTGGTCACCAGGTGG + Intergenic
1016349862 6:143155469-143155491 CAACATTGATGGGGACCTGGAGG + Intronic
1019920491 7:4160342-4160364 CCTTTTGGATGCTGCCCTGGAGG - Intronic
1023933770 7:44724430-44724452 CCTGTTAGATGGTCACCAGGTGG + Intergenic
1027046334 7:74993760-74993782 CTTATTTGCTGGTGAACTGGTGG + Intronic
1029386645 7:100247846-100247868 CTTATTTGCTGGTGAACTGGTGG - Intronic
1030190676 7:106807455-106807477 TCTCTTTGAGGGTGAGCTGTGGG - Intergenic
1034112924 7:148555868-148555890 CCTCTGTGATGCTGACCTAGTGG + Intergenic
1034561980 7:151886257-151886279 CAGAGTTGATGGTGACCTGGAGG + Intergenic
1037459194 8:19092364-19092386 CCAATTTGGTTGTGACCTGGTGG + Intergenic
1037591217 8:20313539-20313561 CCTCTTTGAGGTTCTCCTGGAGG + Intergenic
1038275572 8:26118071-26118093 CCTCTCTGATGGTGACCACCTGG + Intergenic
1040880641 8:52201026-52201048 CCTCTTTGGTGGTGATCTTTTGG - Intronic
1044245826 8:89944233-89944255 CCTGTTTGATGGTCACCGGTTGG - Intronic
1044894755 8:96879761-96879783 CCACTTTCAAGGTAACCTGGTGG + Intronic
1045173548 8:99696647-99696669 TCTCCTCGATGGTGTCCTGGAGG - Intronic
1047865226 8:129016376-129016398 CCTCCCTGGTGGGGACCTGGTGG - Intergenic
1049233088 8:141494354-141494376 CCTGCTTGATGGAGACTTGGGGG - Intergenic
1049479775 8:142816391-142816413 CCTGAGTGATGGTGACGTGGAGG - Intergenic
1051174126 9:14346733-14346755 TTTCTGTGATGGTCACCTGGCGG + Intronic
1051264102 9:15294723-15294745 CCTCTGTGATGGAGTCCTGTAGG - Intronic
1053803594 9:41779257-41779279 CCCCTTTGGCTGTGACCTGGGGG - Intergenic
1054141675 9:61535868-61535890 CCCCTTTGGCTGTGACCTGGGGG + Intergenic
1054191893 9:61990647-61990669 CCCCTTTGGCTGTGACCTGGGGG - Intergenic
1054461374 9:65466591-65466613 CCCCTTTGGCTGTGACCTGGGGG + Intergenic
1054646487 9:67597143-67597165 CCCCTTTGGCTGTGACCTGGGGG + Intergenic
1054741852 9:68814049-68814071 CCACCTTGATGGGGAGCTGGAGG + Intronic
1057454170 9:95192254-95192276 GCTATGTGAAGGTGACCTGGTGG + Intronic
1057553948 9:96072677-96072699 CTTCCTTCAGGGTGACCTGGGGG + Intergenic
1057602944 9:96474546-96474568 TCTCTTTTCTGCTGACCTGGGGG + Intronic
1059177480 9:112180473-112180495 CTTCTTTGAAGGTGGCCTTGGGG - Intergenic
1062582922 9:137236347-137236369 CCTCTTTGGTGGTGGCCTTCGGG - Exonic
1203774811 EBV:66923-66945 GCTCTTTGATGGGGACAGGGCGG + Intergenic
1185946685 X:4384801-4384823 CCTGTTTGATGGTCACCAAGTGG + Intergenic
1186373171 X:8967570-8967592 CCCATTTGATGGTCACCAGGAGG + Intergenic
1187012321 X:15292872-15292894 CCTCTTTGCTGGTGTTTTGGTGG - Intronic
1189377446 X:40476568-40476590 CTTCCTTGAAAGTGACCTGGTGG + Intergenic
1193807483 X:86012363-86012385 CCTGTTTGATGGCCACCAGGTGG - Intronic
1196486750 X:116219362-116219384 CCTCTTTGAGGGTGAAGTGTGGG + Intergenic
1200768088 Y:7097712-7097734 CCTCTTTGCTTTTGAACTGGGGG + Intergenic
1201733899 Y:17236391-17236413 CCTGTTTGATGGTCATCAGGTGG + Intergenic
1202032182 Y:20588652-20588674 TCTCTTTGATGGTGTCATGAGGG - Intronic
1202036525 Y:20642047-20642069 TCTCCTTGATGGTGAACAGGAGG - Intergenic
1202269147 Y:23053651-23053673 CCTCTTTGCTGGTCTTCTGGGGG + Intergenic
1202422139 Y:24687391-24687413 CCTCTTTGCTGGTCTTCTGGGGG + Intergenic
1202448647 Y:24982687-24982709 CCTCTTTGCTGGTCTTCTGGGGG - Intergenic