ID: 984882825

View in Genome Browser
Species Human (GRCh38)
Location 4:184425482-184425504
Sequence GGGCCTCGGGGCCACAGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 314
Summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 280}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984882816_984882825 15 Left 984882816 4:184425444-184425466 CCCACTCTGGCTAGGCCTCAGCA 0: 1
1: 0
2: 0
3: 19
4: 166
Right 984882825 4:184425482-184425504 GGGCCTCGGGGCCACAGTGCAGG 0: 1
1: 0
2: 3
3: 30
4: 280
984882817_984882825 14 Left 984882817 4:184425445-184425467 CCACTCTGGCTAGGCCTCAGCAG 0: 1
1: 0
2: 1
3: 25
4: 250
Right 984882825 4:184425482-184425504 GGGCCTCGGGGCCACAGTGCAGG 0: 1
1: 0
2: 3
3: 30
4: 280
984882815_984882825 22 Left 984882815 4:184425437-184425459 CCACGTGCCCACTCTGGCTAGGC 0: 1
1: 0
2: 1
3: 12
4: 122
Right 984882825 4:184425482-184425504 GGGCCTCGGGGCCACAGTGCAGG 0: 1
1: 0
2: 3
3: 30
4: 280
984882819_984882825 0 Left 984882819 4:184425459-184425481 CCTCAGCAGGATGCAGCTTGACA 0: 1
1: 1
2: 1
3: 14
4: 179
Right 984882825 4:184425482-184425504 GGGCCTCGGGGCCACAGTGCAGG 0: 1
1: 0
2: 3
3: 30
4: 280

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984882825 Original CRISPR GGGCCTCGGGGCCACAGTGC AGG Intronic
900115555 1:1026426-1026448 GTGCCTCGGGGCCACAGGTCCGG + Intronic
900176979 1:1295308-1295330 GGGCCTCCTGGCCACACAGCTGG - Intronic
900213154 1:1467353-1467375 GGGCCCCTGAGCCACAGTGGCGG + Intronic
900218366 1:1494409-1494431 GGGCCCCTGAGCCACAGTGGCGG + Intronic
900220723 1:1508174-1508196 GGGCCCCTGAGCCACAGTGGCGG + Intergenic
900225695 1:1532778-1532800 GGGCCCCGGACCCACAGTGGTGG + Intronic
901034605 1:6328857-6328879 GGCCCTCGGGGCCTGTGTGCTGG + Intronic
901216854 1:7559851-7559873 GGGCCTCAGGGCCTGACTGCAGG + Intronic
902285419 1:15405330-15405352 TGACCTCTGGGCCACAGTGATGG + Intergenic
902338186 1:15765799-15765821 GGGACCCGAGGCCACAGGGCAGG - Intronic
902624406 1:17668265-17668287 GGGCATCGAGCCCACACTGCAGG + Intronic
903652615 1:24930696-24930718 GGGCCGCGGGGTCTCAGGGCCGG + Intronic
904068413 1:27773345-27773367 GGCCCTCGGGGCCCCAGCTCCGG + Exonic
904451543 1:30616007-30616029 GGGTCTAGAGGCCACAGAGCAGG - Intergenic
904587697 1:31589041-31589063 GGGTCCCGGGGCCACTGAGCGGG - Intergenic
905104612 1:35557208-35557230 GGGGCTCAGGGCCACATAGCGGG + Exonic
905105377 1:35560653-35560675 GGGCCTCGGCACCTCATTGCTGG + Exonic
905408462 1:37753080-37753102 GGCCCTCGCGGCCGCAGCGCAGG + Exonic
906152274 1:43594462-43594484 GGGCCTTGGGGACACAGGGTAGG + Intronic
907431437 1:54414411-54414433 GGCCCCCGTGGGCACAGTGCAGG + Intergenic
915247684 1:154568050-154568072 GCGCCACGGGGCCGCAGCGCCGG - Exonic
915269845 1:154746271-154746293 GGGGCACGGGGCCACTGCGCAGG + Intronic
915885083 1:159713520-159713542 GGGCCTCAGGGCCACAGCTGGGG + Exonic
918971435 1:191425374-191425396 CGGCCTCTTGGCCAAAGTGCTGG - Intergenic
920250226 1:204618276-204618298 GGGCCAGGGGGCCACAGCTCTGG - Exonic
920671962 1:208010601-208010623 AGGCCTCGGAGACACAGTGGTGG + Intergenic
921094351 1:211874291-211874313 GGGACTAGGAGCCACAGAGCAGG + Intergenic
922770741 1:228181635-228181657 GGAGCTCTGGGCCACAGGGCAGG + Exonic
922776725 1:228217746-228217768 AGCCCTGGGGGACACAGTGCAGG - Intronic
1062921809 10:1286007-1286029 GGGACTCGGGGCAACGGTCCTGG - Intronic
1063139233 10:3241689-3241711 GTGCTGCGGGACCACAGTGCGGG + Intergenic
1064205587 10:13321122-13321144 GGGGCAAGGGACCACAGTGCTGG - Intronic
1064706807 10:18081451-18081473 GGGCCTTGAGGCCACTGTTCTGG - Intergenic
1067200986 10:44171932-44171954 GAGGCTGGGGGCCACAATGCAGG + Intergenic
1070484123 10:76913394-76913416 GGGATTGGGGGCCAGAGTGCAGG + Intronic
1070625463 10:78047878-78047900 TGGGTCCGGGGCCACAGTGCTGG + Intronic
1071901866 10:90129064-90129086 GGGCCTTGGGGCCTCAGAGATGG - Intergenic
1074248115 10:111714467-111714489 TGCCCTCGGGGCCACTGTGATGG - Intergenic
1075659491 10:124183514-124183536 GGGCCTGAGGGACACAGAGCAGG + Intergenic
1075720894 10:124586693-124586715 TCGCCTCGGGGCCTCTGTGCAGG - Intronic
1075783722 10:125033824-125033846 GGGGCTCCGGGCCACACTGTGGG + Intronic
1076781752 10:132728451-132728473 AGGCCTGGGGGCCACAGAGGCGG + Intronic
1076843348 10:133057270-133057292 GGGCCGTGGGGCCCCTGTGCTGG - Intergenic
1081713679 11:45233917-45233939 GGGCCACGGGGCCTCTGTGAGGG - Intronic
1083547339 11:63558691-63558713 GGGCCTGGGGGGCTCAGAGCTGG + Intronic
1083653745 11:64219368-64219390 GGGCCTGGGGGCACCAGGGCAGG + Intronic
1085309638 11:75508685-75508707 TGGCATGGGGGCCACAGTGGGGG - Intronic
1085527310 11:77171967-77171989 CTGCGTCGGAGCCACAGTGCGGG + Intronic
1086345054 11:85887472-85887494 GGGCCTCTGCACCACAGTGGTGG + Intronic
1086484734 11:87286547-87286569 GGGACCGGGGGCCACAGAGCAGG + Intronic
1089110972 11:116055761-116055783 GGGCCACGGGACCACTGTGGAGG + Intergenic
1089213844 11:116823610-116823632 GGGCCTCGAGGCATCAGTCCCGG - Intergenic
1089770268 11:120797360-120797382 AGGCCTGGGGGACGCAGTGCAGG + Intronic
1090246844 11:125222194-125222216 CTGCCTTGGGGCCACAGTGATGG + Intronic
1090977621 11:131690645-131690667 GGGGCGCGGGGCCTGAGTGCGGG + Intronic
1095642433 12:44500721-44500743 GGGCCTCGGTGCCACGGAGCAGG - Intergenic
1096365551 12:51026132-51026154 GGGCCTCAGGCCCAGAGTCCAGG - Intronic
1097054987 12:56243800-56243822 GAGTCATGGGGCCACAGTGCTGG - Exonic
1097573063 12:61356744-61356766 GGGCCTGGTGACCACACTGCTGG + Intergenic
1103856468 12:123973579-123973601 CGGCCGCGGGCCCGCAGTGCGGG + Exonic
1103909952 12:124346665-124346687 GGGCCTGGTGGCCACGGTGAAGG - Exonic
1104857230 12:131907969-131907991 GGGGGTCCGGGCCACAGTGCCGG + Intronic
1104989639 12:132618587-132618609 GGGCCTCGCGGGGACAGAGCCGG - Intergenic
1105432425 13:20349728-20349750 GGGCCTCGGGGTCACACTCAAGG - Intergenic
1106517105 13:30465233-30465255 GGGCCTGGGGGCGGCAGTGCGGG - Intronic
1108229078 13:48318748-48318770 GGGCCTTGGGGCCACTGGTCTGG + Intronic
1112339789 13:98543640-98543662 GGGCTTCCGGGCCCCAGTGCGGG - Intronic
1112620384 13:101048300-101048322 GGGCCTTCAGACCACAGTGCAGG + Intergenic
1113464289 13:110503229-110503251 GGGACTCCGGGCCCCAGGGCAGG + Exonic
1113990271 14:16023057-16023079 GGGCCCGGGGCCCACAGTCCTGG - Intergenic
1114551117 14:23533408-23533430 GGGCCTGGGGCCCAAAGTACTGG + Exonic
1118589745 14:67392575-67392597 GGGCCTGGGGGCCACAGTCATGG - Intronic
1118613874 14:67562234-67562256 GGGCCTGGGAGCCACTGTCCTGG - Exonic
1119480541 14:74955351-74955373 GGGCCTCGGGGCAGCAGTGAGGG - Exonic
1121315379 14:92958232-92958254 GGGCCTCTGGACCACGGTGTAGG + Exonic
1122873327 14:104651270-104651292 GGGCCTGTGGGCCGCAGGGCAGG + Intergenic
1122956440 14:105073666-105073688 GGGCCTGGGGGCTGCAGAGCCGG + Intergenic
1123030204 14:105447976-105447998 GGGCGTCCAGCCCACAGTGCAGG + Intronic
1123060518 14:105592252-105592274 GGGCCTTGGGGCCACAGGGCGGG + Intergenic
1123084997 14:105713223-105713245 GGGCCTTGGGGCCACAGGGCGGG + Intergenic
1202899114 14_GL000194v1_random:25630-25652 GGGTCTCCGGGGCCCAGTGCAGG + Intergenic
1202899781 14_GL000194v1_random:28370-28392 GGGGCGGGGGGCCACAGCGCCGG - Intergenic
1124377257 15:29136078-29136100 GGGCCTGGGGAACCCAGTGCTGG - Intronic
1124501067 15:30226175-30226197 GGGCGTAGGGGCCACGGTGGGGG - Intergenic
1124742502 15:32312492-32312514 GGGCGTAGGGGCCACGGTGGGGG + Intergenic
1124890371 15:33726577-33726599 GGGCCTGGGGGCCACTGTGCTGG - Intronic
1129455870 15:75675975-75675997 CGGCCTCGGGGACACTGAGCAGG + Exonic
1129660051 15:77548431-77548453 GGGTCCTGGGGCCGCAGTGCTGG - Intergenic
1130273877 15:82466558-82466580 GGGCCTCAGGGCGGGAGTGCAGG - Intergenic
1130466225 15:84193932-84193954 GGGCCTCAGGGCGGGAGTGCAGG - Intergenic
1130498038 15:84479604-84479626 GGGCCTCAGGGCGGGAGTGCAGG + Intergenic
1130588519 15:85198525-85198547 GGGCCTCAGGGCGGGAGTGCAGG - Intergenic
1132466078 16:77991-78013 GGGGCGCCGGGGCACAGTGCGGG + Intronic
1132740085 16:1407797-1407819 TGGCTGCAGGGCCACAGTGCAGG + Intronic
1132802468 16:1761158-1761180 GGGCCTCGGGAACACATAGCGGG - Intronic
1132885445 16:2180235-2180257 GGGCCGGGTGGCCACCGTGCTGG - Exonic
1132932618 16:2466757-2466779 ATGCCTCGGGCCCTCAGTGCAGG - Intergenic
1135149355 16:19992036-19992058 GGGCTTCAAGGCCACAGGGCAGG - Intergenic
1135357211 16:21779427-21779449 CTGCCTCGGGTCCAAAGTGCTGG - Intergenic
1135455715 16:22595543-22595565 CTGCCTCGGGTCCAAAGTGCTGG - Intergenic
1136909429 16:34134129-34134151 GGGCCCGGGGCCCACAGTCCTGG - Intergenic
1138166299 16:54804815-54804837 GGGCCCTGGGGCCAGACTGCTGG + Intergenic
1139391665 16:66609440-66609462 GGGCCGCGGTGACACAGCGCAGG - Exonic
1139475952 16:67202655-67202677 GGGCTTCAGGGCCAGAGTGCGGG - Exonic
1139775037 16:69311577-69311599 GGGCCTGCGGGCCGCAGAGCCGG + Intronic
1139949494 16:70662245-70662267 GGGCATCGTGGCCCCAGGGCAGG - Exonic
1140469270 16:75205516-75205538 GGGGGTGGGGGCCAGAGTGCCGG + Intronic
1140472514 16:75223423-75223445 GGGGGTGGGGGCCAGAGTGCCGG - Intronic
1140477733 16:75247387-75247409 GGGCCCCGGGGACACAATGAGGG - Intronic
1140513949 16:75529103-75529125 GGGCCTGGCGACCACAGTTCGGG + Exonic
1140990728 16:80208949-80208971 AGGGCTCGGGGCCACAGTTGCGG - Intergenic
1142484273 17:236601-236623 GGGCGTCGGGAGCACAGAGCTGG + Intronic
1142806720 17:2375346-2375368 GTGCCCCGTGGCCACAGTGTTGG + Intronic
1144422777 17:15113174-15113196 GTTCCGCGGGGCCACAGTGAGGG + Intergenic
1144527150 17:15999892-15999914 GGGCCGCGGGGCGGCGGTGCCGG + Exonic
1144765200 17:17728819-17728841 GGGCCTCGGGGTCAGAGGACTGG - Intronic
1144827710 17:18115706-18115728 GGGCCTGTGGGCCACAATGAGGG - Intronic
1145787428 17:27603292-27603314 AGGGCTCGGGGCCTCTGTGCTGG + Intronic
1145971485 17:28959058-28959080 GGACCCCGGGACCTCAGTGCTGG - Exonic
1146912350 17:36656972-36656994 GGGCCTCAGGGCCAGACTGGGGG + Intergenic
1147324216 17:39662704-39662726 GGGGCTCTGGGCCAGAATGCAGG - Intronic
1148161273 17:45451479-45451501 GGGCCTTGGGACCAGAGGGCGGG + Intronic
1150139692 17:62717477-62717499 CGGCCCCTGGGCCACAGAGCAGG - Intronic
1150231044 17:63550653-63550675 TGGCCACGGGGCCGCAGTACGGG - Exonic
1150392510 17:64798125-64798147 GGGCCTTGGGACCAGAGGGCGGG + Intergenic
1150410713 17:64938857-64938879 GGGCCTTGGGACCAGAGGGCGGG - Intergenic
1150804298 17:68307094-68307116 GGGCCTCAGAGCCACAGCACAGG - Exonic
1151314328 17:73312271-73312293 GGCCCTGGGGGCCCCAGTGGGGG - Intergenic
1151748413 17:76023712-76023734 GGGGCTCAGGCCCACAGTGATGG - Intronic
1152205447 17:78972220-78972242 GGGCCTCGTGGCTCCAGTACAGG + Exonic
1152207245 17:78980759-78980781 GGGGCCCCGGGCCACACTGCTGG + Intergenic
1152263165 17:79278162-79278184 GGGCCTCGGGGGTCCAGTCCTGG + Intronic
1152363193 17:79841769-79841791 GGACTTCGGGGCCACACAGCAGG + Intergenic
1152649110 17:81483793-81483815 GGGCCTAGAGGCCAGAGTGCTGG - Intergenic
1152782040 17:82230978-82231000 GGGCCTCGAAGCCACAGGGCGGG - Intronic
1152786466 17:82250514-82250536 GAGCCTCGGGGCCCAGGTGCCGG - Intronic
1153238734 18:3012789-3012811 GGGCGTCGGGGCGTCAGTGGTGG - Intronic
1155054627 18:22172258-22172280 GTGCCCCGGGGTCCCAGTGCAGG + Exonic
1155928621 18:31684468-31684490 CGGACTCGGGGCCACTGTCCAGG + Exonic
1156683627 18:39618798-39618820 GGGACCCGGCGCCACAGAGCAGG - Intergenic
1157381526 18:47222571-47222593 AGGCCTGCGGGCCACAGCGCAGG - Intronic
1157735442 18:50044636-50044658 GGGGCTCGGGGCTACCCTGCTGG - Intronic
1160427890 18:78790751-78790773 GGGCCACAGGGGCACAGCGCTGG + Intergenic
1160821760 19:1062280-1062302 GGGCCTCCGGGACACCGCGCAGG - Exonic
1160840462 19:1144435-1144457 AGCCCTCGGGGCCACTGTGCTGG - Intronic
1160983832 19:1828394-1828416 GGGCCGCGGGGCGCCAGGGCGGG + Exonic
1161007029 19:1941925-1941947 GGGCCTCGGGACCAGAACGCGGG - Intronic
1161233679 19:3187763-3187785 GCGCCCTGGGGCCACAGTGGTGG + Intronic
1161319029 19:3632616-3632638 GGGTTTGGGGGCCTCAGTGCAGG - Exonic
1161681289 19:5681071-5681093 GGGCCTCGGGGACCCAGCGCCGG - Exonic
1162096280 19:8311825-8311847 GGGCCTGGGGGCCACAGCAGGGG - Intronic
1162809114 19:13153741-13153763 GGGCCGCGGGGCTGCAGTTCAGG - Exonic
1163638786 19:18450217-18450239 GGGCCTCCGGCCCCCAGTGCTGG + Intronic
1163739105 19:18999799-18999821 TGGCCTGGGGGACACAGTGCTGG - Intronic
1164179490 19:22806940-22806962 GGGCCCCGGGGCCACAGAAGAGG - Intergenic
1165093105 19:33396786-33396808 GGGCATGGGGCCCTCAGTGCTGG + Intronic
1165762058 19:38327193-38327215 GGGCCTGGTGGCCATGGTGCTGG + Exonic
1165928802 19:39343008-39343030 GGGCTTCGGGGCCAAAGGGCGGG - Intronic
1167423196 19:49415649-49415671 GGGCTTCGGGGCCAGGGTGCTGG - Intronic
1168063061 19:53904902-53904924 AGGCCTCGTGGCAACAGGGCTGG - Intronic
1202648330 1_KI270706v1_random:160035-160057 GGGTCTCCGGGGCCCAGTGCAGG - Intergenic
925224675 2:2172791-2172813 GGGGCTTCTGGCCACAGTGCAGG - Intronic
925336485 2:3102492-3102514 GGCCTTCTGGGTCACAGTGCTGG + Intergenic
925414491 2:3659908-3659930 GGGCCTCCAGGCCACAGCACAGG - Intronic
925898863 2:8494439-8494461 GGGCCTGTCGGCCACAGTGGTGG - Intergenic
925912319 2:8581923-8581945 GGGGCTCTGTGCCACACTGCGGG + Intergenic
926170260 2:10548738-10548760 GGGCCCCGGGGCAACAGGACCGG - Intergenic
926821470 2:16855442-16855464 GAGCCCGGGGGCCACAATGCAGG + Intergenic
928907325 2:36381385-36381407 AGGCCCCGGGGCCACAGGCCTGG - Intronic
933656494 2:84891562-84891584 GGGCCTCGGGGGCCAAGTGGAGG - Intronic
933979730 2:87539851-87539873 TGGGCTCGGGGACACAGAGCTGG - Intergenic
935617436 2:105101148-105101170 GGTCCTGGGGGCCACAGTCAAGG - Intergenic
936314091 2:111410940-111410962 TGGGCTCGGGGACACAGAGCTGG + Intergenic
937259404 2:120576096-120576118 GGGCCTCGGGGCCAGGGACCTGG - Intergenic
937956721 2:127425980-127426002 GGGCCACTTTGCCACAGTGCAGG - Intronic
938489831 2:131755646-131755668 GGGTCTCCGGGGCCCAGTGCAGG - Intronic
939613128 2:144332993-144333015 GAGCCTCAGGGCCCCTGTGCGGG + Intergenic
940022673 2:149171913-149171935 GGGCCTGGGAGCCACAAAGCAGG - Intronic
940749833 2:157612785-157612807 GGGCTACAGGGGCACAGTGCTGG - Intronic
940954525 2:159712812-159712834 GGGCCAAGGGGCCACAGCGCAGG + Intronic
941172551 2:162157019-162157041 GGGTCTCGGAGCCTCAGGGCAGG - Intergenic
945035492 2:205700571-205700593 GGGCCCAGGGGCCACAGCCCAGG - Intronic
945833242 2:214810065-214810087 GGGCCTAGGGGCCTCGGGGCAGG + Intergenic
946412390 2:219521829-219521851 GGGCCTCCTGCCCCCAGTGCTGG - Intronic
947515261 2:230798140-230798162 GAGCCCAGGGGCCACAGAGCAGG - Intronic
947860388 2:233354073-233354095 GGGCCTCGGGACGCCAGAGCTGG - Intergenic
948930930 2:241131648-241131670 GGGTGTAGGGGGCACAGTGCAGG + Intronic
949046533 2:241874882-241874904 GGGCCTCGGGGGCCAACTGCAGG + Intergenic
949046589 2:241875040-241875062 GGGCCTCGGGGGCCAACTGCAGG + Intergenic
1168797836 20:623254-623276 GGGCCTCTGGGGCACTGGGCAGG - Intergenic
1170934209 20:20795899-20795921 TGGCCTCGGGGACATAGTCCAGG - Intergenic
1171329536 20:24325553-24325575 GGGCCTGGGGTCCACAGAGCAGG - Intergenic
1171771605 20:29326615-29326637 GGGCCCGGGGCCCACAGTCCTGG + Intergenic
1171813557 20:29763847-29763869 GGGCCCGGGGCCCACAGTTCTGG + Intergenic
1172167385 20:32907526-32907548 GGGCTGTGGGCCCACAGTGCTGG + Intronic
1173622968 20:44450578-44450600 GTGCCTCCAGGCCACAGAGCAGG - Intergenic
1174542736 20:51302862-51302884 TGGCCTCTCAGCCACAGTGCAGG + Intergenic
1175084334 20:56445974-56445996 GGACCACGGGGCCCCGGTGCTGG - Exonic
1175399608 20:58692938-58692960 GGGACTCGGACCCACAGAGCCGG + Exonic
1176035085 20:63032231-63032253 GGACCTCGGGGCCTCAGATCTGG + Intergenic
1176603522 21:8812656-8812678 GGGTCTCCGGGGCCCAGTGCAGG + Intergenic
1176618497 21:9040399-9040421 GGGTCTCCGGGGCCCAGTGCAGG + Intergenic
1176619156 21:9043144-9043166 GGGGCGGGGGGCCACAGCGCCGG - Intergenic
1179471752 21:41614889-41614911 CAGGCTCGGGGCCACAGTGGGGG + Intergenic
1179577473 21:42317066-42317088 GGGCCTGGGAGTCACAGGGCAGG - Intergenic
1179641592 21:42751252-42751274 TGGCCGCAGGGCCACAGGGCTGG - Intronic
1179933798 21:44590373-44590395 GGTCCTCGGGGTCAGAGTCCAGG + Intronic
1179941094 21:44639167-44639189 GGTCCTCGGGGTCAGAGTCCAGG - Intronic
1179995291 21:44971345-44971367 GGGCCCCGGGGACAGAGTGCTGG - Intronic
1180163285 21:46007388-46007410 GGGCCTGGGGGCCACGGAGCAGG - Intergenic
1180317001 22:11284469-11284491 GGGCCCGGGGCCCACAGTCCTGG + Intergenic
1180338326 22:11599040-11599062 GGGCCCGGGGCCCACAGTCCTGG - Intergenic
1180345805 22:11704213-11704235 GGGTCTCCGGGGCCCAGTGCAGG + Intergenic
1181116472 22:20635178-20635200 GGGCCTCAGGGTCACTGTGAGGG - Intergenic
1182415873 22:30221196-30221218 GGCCTTCGTGGCCACAGAGCCGG + Intergenic
1183324102 22:37182165-37182187 GGGCCTCTGGGCCACCCTCCCGG - Exonic
1183391447 22:37547510-37547532 AGGCCTCTGGGCCCCAGTCCTGG + Intergenic
1183787214 22:40036714-40036736 GGGTCTAGGGGCCACAGTCCTGG + Exonic
1184213560 22:43051490-43051512 GGGCCTGGGGGACAGGGTGCAGG + Intronic
1185413437 22:50697583-50697605 GGGCCCCGGGGCGGCGGTGCGGG - Intergenic
949281540 3:2352719-2352741 GGGACTGGGTGCCACAGAGCAGG - Intronic
950100465 3:10353483-10353505 GGGCCTGAGGGCCACGCTGCAGG + Intronic
954106016 3:48410211-48410233 GGTCCTCTGGGCCTCAGGGCAGG - Intronic
954327892 3:49873481-49873503 GGGCCCTGGTGCCACTGTGCTGG - Intergenic
957943654 3:87036596-87036618 GGGCCCAGTGGCCACAGTGGTGG + Intergenic
959846100 3:111035688-111035710 GGGCTACAGTGCCACAGTGCTGG + Intergenic
961367252 3:126407882-126407904 GGAGGTCGGAGCCACAGTGCAGG - Intronic
961547346 3:127644528-127644550 TGGCCTCAGGACCACAGTGGAGG + Intronic
964129682 3:153272862-153272884 GAGCCTTGAGACCACAGTGCTGG + Intergenic
966874526 3:184314772-184314794 GGGCCGCGGGGCCAGGGCGCCGG - Intronic
969239526 4:5889420-5889442 GGGGCTGGTGTCCACAGTGCTGG - Intronic
969247919 4:5947621-5947643 GGCCCTCGGGGCTGCAGTGCGGG - Intronic
969616476 4:8255846-8255868 GGGGCACGGGGCCACAGAGAAGG + Intergenic
969927637 4:10600120-10600142 GGGCCCAGAGGCCACAGTGTGGG - Intronic
974839737 4:67286722-67286744 GGGACTGGGTGCCACAGAGCAGG + Intergenic
977722355 4:100254424-100254446 GGGCCTCCAAGCCATAGTGCTGG + Intergenic
978044289 4:104107163-104107185 GGGCTGCAGGGCCACAGGGCTGG + Intergenic
984823850 4:183906743-183906765 GATCCTCGGGGCCTCAGCGCCGG - Exonic
984882825 4:184425482-184425504 GGGCCTCGGGGCCACAGTGCAGG + Intronic
984918158 4:184741538-184741560 GGGACTGGGCGCCACAGAGCAGG - Intergenic
985530198 5:429539-429561 GGGTCTCGGAGTCACAGAGCAGG - Intronic
985772931 5:1824482-1824504 GGGCACAGGGGCCACGGTGCAGG - Intergenic
986733179 5:10649793-10649815 GGGCCCCGGGACCCCAGGGCGGG - Exonic
987303302 5:16616572-16616594 GGGCCCCGGGGACCCAGTGCAGG - Intronic
992220442 5:74566785-74566807 GGACCCAGGGGCCACAGTCCTGG - Intergenic
995784688 5:115816038-115816060 GGGCTCCGCGGCCACAGCGCAGG - Intronic
995991670 5:118247389-118247411 GGGCCTATGGGTCACAGTGTGGG - Intergenic
998095326 5:139393055-139393077 GGGGCGGGGGGCCCCAGTGCTGG + Exonic
1001276802 5:170357207-170357229 AGGCTTCCGAGCCACAGTGCAGG - Intronic
1002067426 5:176658949-176658971 GGGCCAAGGAGCCACATTGCTGG - Exonic
1003072048 6:2952672-2952694 TGGCCTCCGTGCCACACTGCAGG - Intronic
1006163135 6:32049538-32049560 GGCCTCCGGGGCCTCAGTGCTGG + Intronic
1006163777 6:32052938-32052960 GGGCTCCGGGGCCTCCGTGCTGG + Intronic
1006513719 6:34534758-34534780 GGTCCTCAGGGCCCCAGAGCGGG + Exonic
1006830250 6:36964048-36964070 GGGCTGCTGGGCCACAGAGCAGG - Intronic
1007082072 6:39114829-39114851 TGGCCTCGGAGCCACAGTCGAGG - Intronic
1009964814 6:70567014-70567036 TGGCCTCGGGGCCACGGTCGCGG + Intronic
1011649054 6:89489135-89489157 GGGTCTCAGTGCCACAGGGCTGG + Intronic
1015143115 6:129958121-129958143 GGGCCCCTGGGACACAGTGGAGG - Intergenic
1015618692 6:135106805-135106827 GGGCCTCGGGGCAGCAGTTCTGG + Intergenic
1017054265 6:150423889-150423911 GGGCATGTGGGCCACAGTGGGGG - Intergenic
1018023862 6:159789277-159789299 GGGCCTCGGGGCCCCGCAGCCGG - Intronic
1018821494 6:167377484-167377506 TTGCTTGGGGGCCACAGTGCAGG - Intronic
1018857302 6:167683904-167683926 AGGCCTCCAGGCCTCAGTGCTGG - Intergenic
1018962405 6:168458107-168458129 CGGCCTCTGGGTCACACTGCAGG - Intronic
1019483080 7:1275197-1275219 GGGACTCGGGGCCAACGGGCAGG - Intergenic
1019925502 7:4189481-4189503 GGGGCTAAAGGCCACAGTGCTGG - Intronic
1023064805 7:36366934-36366956 GGGCCTCGGGGCGACGATGCTGG - Intronic
1023670878 7:42575337-42575359 GGCCCTCGGGGCCACTCTGCCGG - Intergenic
1024063828 7:45717116-45717138 GTGCCTGGGGTCCACAGAGCCGG + Exonic
1024292650 7:47816041-47816063 AGGTGTCGGGGCCACAGGGCTGG + Intronic
1024556386 7:50606442-50606464 GGGCCTCGGGGCTCCCGGGCCGG - Intronic
1025854339 7:65264737-65264759 GGGTCTGGGGTCCTCAGTGCTGG + Intergenic
1026979140 7:74516477-74516499 GGGCCTCAGGGCCCCAGTGGTGG + Intronic
1026979245 7:74516927-74516949 GGGGCTCGGGGGCACAGAGGAGG - Intronic
1028856180 7:95596554-95596576 GGGACTCGGGGGGAGAGTGCGGG - Intergenic
1032024926 7:128433635-128433657 GGGCCTTAGAGCCACAGTGGTGG + Intergenic
1032845159 7:135745774-135745796 GGGGCTGGGGGCCAAAGGGCAGG + Intronic
1033604645 7:142917737-142917759 GGACCCCGGGGACAGAGTGCTGG - Intronic
1035344606 7:158189946-158189968 GTGCCTCGGCACCACAGAGCAGG - Intronic
1036211217 8:6842744-6842766 GGGATTCAGGGCCACAGTGGTGG - Intergenic
1037835624 8:22213308-22213330 GGGCCCTGGGGCCACACTGGTGG - Intergenic
1038584554 8:28777298-28777320 GGGCCACGGAACCACTGTGCTGG - Intronic
1038612828 8:29070620-29070642 GGGCCTCGGGGGCACCCAGCCGG + Exonic
1039890847 8:41684288-41684310 GGGCCTGGGGGCCATTCTGCAGG + Intronic
1039909199 8:41810756-41810778 GGGCCTCATGACCACAGGGCCGG + Intronic
1048189457 8:132274874-132274896 GGGCCTCAGGGCTCCTGTGCAGG - Intronic
1049246823 8:141567331-141567353 TGGCCAGGGGGCCAGAGTGCAGG + Intergenic
1049655514 8:143795288-143795310 TGGCCTCGGGCCCCCAGTGCAGG + Exonic
1050127005 9:2367785-2367807 GGGCCTAGGCTCCACACTGCTGG - Intergenic
1051699840 9:19810055-19810077 GGGCATAGAGGCCACACTGCTGG + Intergenic
1055654987 9:78442408-78442430 GGGACTGGGTGCCACAGAGCAGG - Intergenic
1056475269 9:86946725-86946747 GGCCCGCGGGGGGACAGTGCCGG - Exonic
1056789184 9:89614786-89614808 GGGCCTAGGGGCCACATAGAAGG - Intergenic
1057152398 9:92807720-92807742 GTGCCGCAGGGCCAGAGTGCGGG + Intergenic
1057189177 9:93076903-93076925 GGGCCCTGGGGCCAAAGAGCAGG + Intronic
1057228212 9:93303616-93303638 GGGCCTGGTGGGCGCAGTGCAGG - Intronic
1058876821 9:109251888-109251910 GGGCCTCGGGGACGCCGTGAGGG + Intronic
1059281182 9:113135659-113135681 GGGCCTCAGAGTGACAGTGCGGG + Intergenic
1059337692 9:113579544-113579566 GGGCCTTGGGTCTAGAGTGCTGG - Intronic
1060821027 9:126661685-126661707 GGGCCCCGCAGCCACACTGCAGG - Intronic
1061899401 9:133665364-133665386 GGTCCTGGGGGCCACAGCCCTGG - Intronic
1062269303 9:135701366-135701388 GGCCCTCGTGGGCACAGTCCTGG + Intergenic
1062376845 9:136265695-136265717 GGGCCTCGTGGCCAGAGTGGAGG - Intergenic
1062481257 9:136753617-136753639 GGGTCTCGGGGGCACAGTTCTGG + Intergenic
1062500606 9:136850414-136850436 GGGCCCAGGGCCCAAAGTGCTGG - Intronic
1062537263 9:137026535-137026557 GGCCCACTGGGCCACAGTGGAGG - Intronic
1185459381 X:327884-327906 GGGCCTCGTGCCCACACCGCCGG - Intergenic
1190051979 X:47157253-47157275 GGGCCTCTGGACCACGGTGTAGG + Intronic
1190054768 X:47175182-47175204 GGGACACAGGGCCACAGGGCAGG - Intronic
1200072949 X:153537991-153538013 GGTCCCCAAGGCCACAGTGCAGG + Intronic
1200089453 X:153627568-153627590 AGGCCTCGGGGCCACATTAAGGG - Intergenic
1200151097 X:153951857-153951879 GGGCAGCAGCGCCACAGTGCTGG + Exonic
1201152198 Y:11100483-11100505 GGGTCTCCGGGGCCCAGTGCAGG + Intergenic