ID: 984883377

View in Genome Browser
Species Human (GRCh38)
Location 4:184429377-184429399
Sequence ACTGCACTGGCCGTGTTTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 109}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984883372_984883377 -1 Left 984883372 4:184429355-184429377 CCTAGAGGGAGGCTTTATCCCCA 0: 1
1: 0
2: 2
3: 7
4: 155
Right 984883377 4:184429377-184429399 ACTGCACTGGCCGTGTTTTGAGG 0: 1
1: 0
2: 0
3: 5
4: 109
984883368_984883377 12 Left 984883368 4:184429342-184429364 CCCCAGGAATTTGCCTAGAGGGA 0: 1
1: 0
2: 1
3: 11
4: 116
Right 984883377 4:184429377-184429399 ACTGCACTGGCCGTGTTTTGAGG 0: 1
1: 0
2: 0
3: 5
4: 109
984883370_984883377 10 Left 984883370 4:184429344-184429366 CCAGGAATTTGCCTAGAGGGAGG 0: 1
1: 0
2: 3
3: 10
4: 157
Right 984883377 4:184429377-184429399 ACTGCACTGGCCGTGTTTTGAGG 0: 1
1: 0
2: 0
3: 5
4: 109
984883369_984883377 11 Left 984883369 4:184429343-184429365 CCCAGGAATTTGCCTAGAGGGAG 0: 1
1: 0
2: 0
3: 10
4: 146
Right 984883377 4:184429377-184429399 ACTGCACTGGCCGTGTTTTGAGG 0: 1
1: 0
2: 0
3: 5
4: 109
984883363_984883377 23 Left 984883363 4:184429331-184429353 CCCACACTCCTCCCCAGGAATTT 0: 1
1: 0
2: 4
3: 26
4: 255
Right 984883377 4:184429377-184429399 ACTGCACTGGCCGTGTTTTGAGG 0: 1
1: 0
2: 0
3: 5
4: 109
984883361_984883377 29 Left 984883361 4:184429325-184429347 CCAGGACCCACACTCCTCCCCAG 0: 1
1: 0
2: 1
3: 71
4: 602
Right 984883377 4:184429377-184429399 ACTGCACTGGCCGTGTTTTGAGG 0: 1
1: 0
2: 0
3: 5
4: 109
984883365_984883377 15 Left 984883365 4:184429339-184429361 CCTCCCCAGGAATTTGCCTAGAG 0: 1
1: 0
2: 0
3: 8
4: 117
Right 984883377 4:184429377-184429399 ACTGCACTGGCCGTGTTTTGAGG 0: 1
1: 0
2: 0
3: 5
4: 109
984883364_984883377 22 Left 984883364 4:184429332-184429354 CCACACTCCTCCCCAGGAATTTG 0: 1
1: 1
2: 2
3: 32
4: 336
Right 984883377 4:184429377-184429399 ACTGCACTGGCCGTGTTTTGAGG 0: 1
1: 0
2: 0
3: 5
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984883377 Original CRISPR ACTGCACTGGCCGTGTTTTG AGG Intronic
906101753 1:43268217-43268239 ACTGCACTGACCTTTTTCTGAGG + Intronic
910877999 1:91895606-91895628 TCTGGACTGGCCGTGTGTGGTGG - Intronic
921361809 1:214336919-214336941 ACTGCACATGCCGTACTTTGAGG + Exonic
922648950 1:227319533-227319555 ACTGCAATGACCTAGTTTTGTGG - Intergenic
1066679532 10:37923836-37923858 ACTGCTCTGGGCCTGTTTTCTGG - Intergenic
1069776563 10:70930624-70930646 TCTGCTGTGGCCATGTTTTGCGG - Intergenic
1071375570 10:84998881-84998903 ACTGCACTGGCTGTCTTAGGAGG - Intergenic
1074626690 10:115197654-115197676 ACTGCACTGGCTTTGGTATGGGG - Intronic
1077140876 11:1024348-1024370 ACTGCAGTGGCCGTGGTTAGCGG - Intronic
1077911938 11:6579950-6579972 ACTGCACTGCCTGTGGTTGGGGG - Intronic
1079158795 11:17973830-17973852 ACTCCACTGTCAGTGGTTTGGGG + Intronic
1081306971 11:41524489-41524511 AGTGCACTGTGTGTGTTTTGAGG + Intergenic
1084647645 11:70468410-70468432 ACAGGACTGCCCGTGCTTTGTGG - Intronic
1085020994 11:73207634-73207656 ACTGTACTGGCTGTGTTTAATGG - Intergenic
1085400118 11:76230793-76230815 ACTGCCCTGGCTGGGGTTTGGGG - Intergenic
1087080572 11:94167214-94167236 ACTGCACTGCCTGGGTTTAGGGG + Intronic
1088450930 11:109980431-109980453 ACTGCAGAGGCAGTGTTTAGTGG + Intergenic
1098253770 12:68595523-68595545 TCAGCAATGGCTGTGTTTTGGGG - Intergenic
1101959886 12:109241052-109241074 ACTGGAATTGCTGTGTTTTGGGG + Intronic
1103737009 12:123066917-123066939 ACTGCACTGGCCGGGGAGTGTGG - Intronic
1103839352 12:123850100-123850122 AAGGCAGTGGCCTTGTTTTGGGG + Intronic
1103852901 12:123944882-123944904 ACTGTACTTGCCGTGTCCTGGGG - Intronic
1110084718 13:71363948-71363970 ACTAGACTGGCCGAGTTTTCTGG - Intergenic
1113638487 13:111938986-111939008 ACTGCACTGGCCAGATTTTAAGG + Intergenic
1115803292 14:37021035-37021057 ACTGCACTGGCAATGTATTTAGG + Intronic
1120992541 14:90390657-90390679 ACTGAAATGGCAGGGTTTTGGGG - Intergenic
1121109171 14:91300745-91300767 GCTGCACTGGCCATCTCTTGGGG + Intronic
1121757970 14:96419099-96419121 ACTGCACAGGCTGTGGGTTGTGG + Intronic
1125426600 15:39555411-39555433 ACTGCAATGGCAGAGTTGTGAGG + Intergenic
1129007288 15:72384504-72384526 ACTGCACCTGGCCTGTTTTGAGG + Intergenic
1130511372 15:84592485-84592507 ACAGCACTGGCCGGGTGTGGTGG - Intergenic
1133168343 16:3964696-3964718 ATTGCACTGGCCATGCTTTGAGG + Exonic
1142403263 16:89872251-89872273 ACTGCACCTGCCGTGGTTTAGGG - Intergenic
1143377892 17:6478148-6478170 ACTGCTCTGGCCGGGTGTGGGGG - Intronic
1144299669 17:13911535-13911557 ACTGCACTTGGCCTTTTTTGTGG - Intergenic
1144429437 17:15177607-15177629 ACAGCACTGTCCGTGTCTTCTGG + Intergenic
1144658904 17:17055817-17055839 CCTGCCCTGGCATTGTTTTGTGG + Intronic
1145124636 17:20290099-20290121 ACTGCACTGGTGGTGCTCTGGGG - Intronic
1153155185 18:2140970-2140992 ACTGTACTGTACTTGTTTTGTGG + Intergenic
1155283299 18:24263505-24263527 ATTGCAATCGCAGTGTTTTGGGG - Intronic
1164927638 19:32142819-32142841 ACTGCCTTGTCCATGTTTTGGGG - Intergenic
1166249586 19:41559223-41559245 ACTGCACAGACCATGTTTTGTGG + Intronic
1167981612 19:53280860-53280882 ACATCACTGGCCGTGTCATGGGG - Intergenic
1167984481 19:53302802-53302824 ACATCACTGGCCGTGTCATGGGG + Intergenic
1168218341 19:54942857-54942879 ACTGTACTGGCCGGGTATGGTGG + Intronic
925485056 2:4319429-4319451 ACAACAATGGCCTTGTTTTGAGG + Intergenic
928825775 2:35419747-35419769 TCTGCAGTGGCCCTGCTTTGTGG - Intergenic
931091097 2:58887312-58887334 ACTGAACTGGCCATCTTTTTAGG + Intergenic
934767965 2:96891103-96891125 CCTGCACTGGCCGTGTGTCCTGG - Intronic
934853367 2:97714854-97714876 ACTGCCCTGGCAGTGTTGCGGGG + Intronic
935249211 2:101247009-101247031 ACTGCAAAGCCCATGTTTTGTGG + Intronic
936374694 2:111930479-111930501 GCTGCACTGGCTTTTTTTTGGGG - Intronic
937213053 2:120290151-120290173 ACCACACTGGCTGTTTTTTGTGG + Intronic
939144469 2:138396050-138396072 ACTGCACTGCCTGGGGTTTGGGG - Intergenic
942778558 2:179613703-179613725 ACTGCACTGTCTGTGATTGGGGG + Intronic
1171989774 20:31687028-31687050 ACTACACTGGCCGAGTCTGGTGG + Intronic
1172079940 20:32332198-32332220 TCTGCAGTGGGCCTGTTTTGTGG + Exonic
1172300735 20:33848262-33848284 TGTTTACTGGCCGTGTTTTGAGG + Intronic
1176328225 21:5520598-5520620 CCTGCACTGGCCCTGTTCAGAGG - Intergenic
1176399532 21:6300353-6300375 CCTGCACTGGCCCTGTTCAGAGG + Intergenic
1176437625 21:6688751-6688773 CCTGCACTGGCCCTGTTCAGAGG - Intergenic
1176461887 21:7015821-7015843 CCTGCACTGGCCCTGTTCAGAGG - Intergenic
1176485448 21:7397599-7397621 CCTGCACTGGCCCTGTTCAGAGG - Intergenic
1179280305 21:39928277-39928299 GCTGCACTGGCCCTGTGCTGTGG + Intronic
1183615550 22:38943058-38943080 ATTGCTCTGACCGTGTTTTCTGG - Intergenic
954532151 3:51330298-51330320 ACTGCACTGGCAGGCTTTAGAGG + Intronic
954821605 3:53333971-53333993 ACTGCACTGGCCCTGTATGCTGG - Intronic
955317767 3:57953114-57953136 ACTGCCCTTGCCCTGTTTTCTGG - Intergenic
960688718 3:120321294-120321316 TCTGAACTGGAAGTGTTTTGAGG - Intergenic
961694725 3:128696720-128696742 ACTGCACCTGGCCTGTTTTGTGG - Intergenic
961968097 3:130927056-130927078 AAAGCACTGGCCCTGCTTTGGGG - Intronic
963197267 3:142546174-142546196 CCTGCTCTGTCTGTGTTTTGAGG + Intronic
964211937 3:154238403-154238425 ACTGCATTTGCTGTTTTTTGAGG + Intronic
964630314 3:158802528-158802550 ACTGAGCTGGGCGAGTTTTGTGG + Intronic
966184471 3:177215491-177215513 ACTGCACTGGCCCTTTCCTGGGG + Intergenic
969525911 4:7703959-7703981 ACTGCCCTGGGGGTGTTTTCTGG - Intronic
971589349 4:28447274-28447296 ACTGGGCTGGCTGTCTTTTGGGG - Intergenic
973021772 4:45211537-45211559 GGTGCACTGGAGGTGTTTTGGGG - Intergenic
974240347 4:59238252-59238274 ACTGCAATGGCAGTCTGTTGTGG + Intergenic
984883377 4:184429377-184429399 ACTGCACTGGCCGTGTTTTGAGG + Intronic
985384807 4:189434307-189434329 ACTGCACTGCCTGGGGTTTGGGG + Intergenic
999298852 5:150477918-150477940 ACAGCACTGGCCGGGTGTGGTGG + Intergenic
1000573142 5:162940020-162940042 ACTGCACTGGCTGTTCTTTGAGG - Intergenic
1002894113 6:1365505-1365527 TCTGCACATGCCGTGGTTTGTGG - Intergenic
1015234485 6:130954883-130954905 TCTGCACTAGCCGTGTTTACTGG - Intronic
1015746204 6:136512507-136512529 ACTGAACTGGCAGTATTCTGAGG - Intronic
1017440382 6:154459412-154459434 ACCCCACTGGCCATTTTTTGGGG + Intronic
1019211668 6:170410683-170410705 ACTGCCCTGGCCATGTGCTGTGG - Intergenic
1020527060 7:9275287-9275309 ACTGCACAGTCCGTGTTCTTAGG - Intergenic
1022470658 7:30680242-30680264 ACTGCACAGGCACTGTATTGAGG - Intronic
1032704607 7:134411039-134411061 ACTGCAGGGGCCGTGCTGTGGGG + Intergenic
1032985145 7:137329426-137329448 ACTTCCCTTGCTGTGTTTTGAGG - Intronic
1038192769 8:25339126-25339148 AGTGCACTGGCCATGTCTGGAGG + Intronic
1039703070 8:39981037-39981059 AATGCACTGGCCGGGTGCTGGGG - Intronic
1039807337 8:41011951-41011973 ACTGTACTTGCCTTTTTTTGCGG + Intergenic
1041157721 8:55005339-55005361 GCCGCACTGGGCTTGTTTTGTGG - Intergenic
1042665366 8:71198709-71198731 ACTGTACTTGCCATGTTGTGAGG + Exonic
1042767135 8:72334871-72334893 ACTGCACTGGCCGGGCATGGTGG - Intergenic
1043104555 8:76090853-76090875 ACTGCACCCGGCCTGTTTTGTGG + Intergenic
1045025358 8:98081638-98081660 ACTACACTGGCCGGGTGCTGTGG + Intronic
1047219804 8:122910329-122910351 AATGAATTGGCTGTGTTTTGGGG - Intronic
1050837767 9:10105421-10105443 TCTGCAGTGGCAGTGTTTTATGG + Intronic
1051680566 9:19603622-19603644 ACTGCCCTGGCCTTATTCTGAGG + Intronic
1055306000 9:74929688-74929710 ACTGCACAGCCCTTGTTTTGGGG - Intergenic
1056918701 9:90766452-90766474 ACTGCAAGGGCTGGGTTTTGAGG - Intergenic
1058153318 9:101486099-101486121 ACTGCGCTCGCGGTGTCTTGGGG - Intronic
1060328640 9:122643665-122643687 ACTGCACTGCCTGGGTTTGGAGG - Intergenic
1203433880 Un_GL000195v1:119871-119893 CCTGCACTGGCCCTGTTCAGAGG + Intergenic
1203617683 Un_KI270749v1:83234-83256 ACTGCACTGGCCCTGGCTAGAGG - Intergenic
1185476687 X:419591-419613 GCTGCACCGACCGCGTTTTGTGG - Intergenic
1187295290 X:17993432-17993454 ACTTAACTGACTGTGTTTTGTGG + Intergenic
1187464138 X:19514041-19514063 ACTCCACCGTCAGTGTTTTGGGG + Intronic
1198670690 X:139077053-139077075 ACTGCACCTGCACTGTTTTGGGG + Intronic
1199291935 X:146114184-146114206 ACTGCACTGCCAGTTGTTTGGGG + Intergenic
1199921091 X:152404851-152404873 ACTGCACTCTATGTGTTTTGTGG - Intronic