ID: 984885026

View in Genome Browser
Species Human (GRCh38)
Location 4:184442315-184442337
Sequence TCACCTCCATGCTCTCTTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 189}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984885018_984885026 18 Left 984885018 4:184442274-184442296 CCATACTCCAAAATAAAGATACT 0: 1
1: 0
2: 0
3: 20
4: 356
Right 984885026 4:184442315-184442337 TCACCTCCATGCTCTCTTTAAGG 0: 1
1: 0
2: 2
3: 10
4: 189
984885017_984885026 19 Left 984885017 4:184442273-184442295 CCCATACTCCAAAATAAAGATAC 0: 1
1: 0
2: 1
3: 23
4: 260
Right 984885026 4:184442315-184442337 TCACCTCCATGCTCTCTTTAAGG 0: 1
1: 0
2: 2
3: 10
4: 189
984885019_984885026 11 Left 984885019 4:184442281-184442303 CCAAAATAAAGATACTCGCCCTC 0: 1
1: 0
2: 1
3: 8
4: 65
Right 984885026 4:184442315-184442337 TCACCTCCATGCTCTCTTTAAGG 0: 1
1: 0
2: 2
3: 10
4: 189
984885020_984885026 -7 Left 984885020 4:184442299-184442321 CCCTCTCTCCACCCCTTCACCTC 0: 1
1: 1
2: 12
3: 188
4: 1722
Right 984885026 4:184442315-184442337 TCACCTCCATGCTCTCTTTAAGG 0: 1
1: 0
2: 2
3: 10
4: 189
984885021_984885026 -8 Left 984885021 4:184442300-184442322 CCTCTCTCCACCCCTTCACCTCC 0: 1
1: 0
2: 19
3: 302
4: 2346
Right 984885026 4:184442315-184442337 TCACCTCCATGCTCTCTTTAAGG 0: 1
1: 0
2: 2
3: 10
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984885026 Original CRISPR TCACCTCCATGCTCTCTTTA AGG Intronic
902400214 1:16153333-16153355 CCACCTCCCTGCTTCCTTTAGGG - Intronic
902660445 1:17897136-17897158 TCACCTCCTTACTCTCTATTGGG - Intergenic
903158388 1:21466066-21466088 TGACCTCCATGCCCTTTTCAGGG + Intronic
906111659 1:43327340-43327362 TTACTTCTATGCTTTCTTTAAGG - Intergenic
907489844 1:54801740-54801762 CCACCTCCCTCCTCTCTTTTTGG + Intergenic
908288551 1:62637783-62637805 TTACTTCCATGTTCTCTTTTAGG - Intronic
908669294 1:66528736-66528758 TTACTTCCATGCACTCTTTCTGG + Intergenic
909258183 1:73451137-73451159 TCAACTCCAGGCTTTCTTGATGG + Intergenic
909597197 1:77419743-77419765 TCACCTCCATTCTCTCTTTCTGG - Intronic
911530077 1:99033467-99033489 TCACCTCCAGGATTTCTTTTTGG - Intergenic
911874825 1:103147300-103147322 TAATTTCCATGCTCTTTTTAGGG - Intergenic
913334673 1:117698313-117698335 TCACCTACCTGCTCTCATCAGGG - Intergenic
915282381 1:154831330-154831352 CCACCTCCATCCTCCCTGTAGGG - Intronic
915454322 1:156029365-156029387 TTTTCTCCATGCTCTCTCTAGGG - Intergenic
915834623 1:159166062-159166084 TCTCCTCCATGTGCTCTTTGAGG - Intergenic
916155912 1:161847612-161847634 TCACCTTGATGATCTCTTAACGG + Intronic
919872742 1:201835286-201835308 TATCCTCCATGCTCTCCTTTGGG + Intronic
920058229 1:203208232-203208254 TCAGCTCGATGCTTTTTTTAAGG - Intergenic
923378306 1:233389113-233389135 TCACCTCCATGATTTCCATATGG + Intergenic
1063647176 10:7896811-7896833 TCATCTAGATTCTCTCTTTAAGG + Intronic
1067905878 10:50290436-50290458 TCACCTCCATGCCTTCCTTGAGG + Intergenic
1068431653 10:56940902-56940924 TAACCTCCTTACTCTCTCTAAGG + Intergenic
1070638891 10:78151881-78151903 TCCCCTCCCTGCTGTCTTTCAGG + Intergenic
1070695920 10:78562919-78562941 TCACCTCCAAGATCTCTAAAGGG - Intergenic
1071096556 10:81981938-81981960 TCACATCCATAATTTCTTTATGG + Intronic
1074136366 10:110630383-110630405 TCATCTCCAGGTTCTCTTTGTGG + Intergenic
1077324036 11:1955994-1956016 TCCCCACCATTGTCTCTTTAGGG - Intronic
1078119049 11:8487628-8487650 TGACCTCCTTGCTGCCTTTATGG - Intronic
1080136653 11:28862949-28862971 TTACCTCCATGCTGTCCTTCAGG + Intergenic
1080773908 11:35367888-35367910 TCACTTCCACCCTCTATTTATGG - Intronic
1081355901 11:42113337-42113359 ACACCACCATACTCTCTTCATGG + Intergenic
1081408739 11:42729585-42729607 TCAGCTCCATTCTAACTTTATGG + Intergenic
1083643241 11:64156983-64157005 TCACCTCCATGTCCTCTTATCGG + Intronic
1084226143 11:67715829-67715851 TCACCTTCATCCTCTTTTTCTGG - Intergenic
1084263982 11:67995708-67995730 TCACCTTCATCCTCTTTTTCTGG - Exonic
1087283160 11:96234702-96234724 ACACCTTCAAGCTTTCTTTATGG + Intronic
1090794234 11:130120758-130120780 ACACCTCCATCCGCTCTTTGTGG - Exonic
1091357499 11:134948782-134948804 TCTCCTCCATGGGCTCTCTAAGG + Intergenic
1202807022 11_KI270721v1_random:11189-11211 TCCCCACCATTGTCTCTTTAGGG - Intergenic
1091802768 12:3334799-3334821 TGATCTCCATGCTCTCCCTAAGG + Intergenic
1092097322 12:5853739-5853761 TCACCTCCTTTCTCTCTTCTCGG - Intronic
1092692895 12:11134425-11134447 TAAGTTCAATGCTCTCTTTATGG + Exonic
1094516798 12:31136954-31136976 TCAGCTCCATTCTAACTTTATGG - Intergenic
1095362330 12:41357878-41357900 TCACCTCTAGCCTCTCTCTAAGG + Intronic
1096526071 12:52211135-52211157 CCACCTCCATGCTCCCTCTCTGG - Intergenic
1096611814 12:52806975-52806997 TCACCTCCATCCTCTGTCTCTGG - Exonic
1097004172 12:55903078-55903100 TGACCACCTTTCTCTCTTTATGG + Intronic
1101560182 12:105849777-105849799 TCTCCTTCACGCTCTCTTTGAGG + Intergenic
1103224429 12:119274716-119274738 TCATCTGCATGCTCCCTCTAGGG + Intergenic
1106225036 13:27778909-27778931 TCCCCACCATACTCCCTTTAGGG - Intergenic
1106310303 13:28548454-28548476 TCCCCTCTATGCTCTCTTCTGGG - Intergenic
1107092106 13:36492962-36492984 TCACAGCCATGATGTCTTTAAGG - Intergenic
1107782383 13:43917688-43917710 TCACCTCTGTGCTCACTTTCAGG - Intergenic
1108089036 13:46826512-46826534 TCATCTCCATGTTCTATATAAGG - Intergenic
1108909690 13:55530624-55530646 TCATCTCCCTTCTCTCTTTTTGG - Intergenic
1110117073 13:71831888-71831910 AAACGACCATGCTCTCTTTATGG + Intronic
1111196495 13:84881531-84881553 TCATCTCTATGCCTTCTTTATGG - Intergenic
1114928196 14:27431912-27431934 TCAGCTCCAGGCTTTTTTTAAGG - Intergenic
1117286299 14:54288701-54288723 TCAAGTCCATCCCCTCTTTATGG - Intergenic
1119137898 14:72237734-72237756 TCACCTGCATGCTCCCTCTCAGG - Intronic
1119971627 14:78977256-78977278 TGTCCTCCATGCTGACTTTATGG + Intronic
1126909702 15:53404682-53404704 TCATCTCCATGCTCTCTTTGGGG + Intergenic
1126988095 15:54338381-54338403 TCACCACCATGCTCGCTTTTGGG - Exonic
1127939004 15:63674430-63674452 TAATCCCAATGCTCTCTTTATGG + Exonic
1128074544 15:64818090-64818112 ACTGCTCCATGCTCTCCTTAGGG - Exonic
1129626956 15:77211422-77211444 TCACCTCCATGGTATCTTAGTGG - Intronic
1129755863 15:78098578-78098600 TCACCTCCATGCTTTCCTCCTGG - Exonic
1132512263 16:349564-349586 TCACCATCATGCTCTCATAAGGG + Intronic
1135850894 16:25962680-25962702 TCACCTTCATGCTATTTTCAAGG - Intronic
1136579177 16:31141719-31141741 TCACCACCATGCTCTGTGTGTGG + Exonic
1139043068 16:63023044-63023066 TCTCATCAATGCTCTGTTTATGG + Intergenic
1140591246 16:76355373-76355395 TGACCTCCATTCTCTCTCCAAGG - Exonic
1140957500 16:79879001-79879023 TCTCTTCCCTTCTCTCTTTAAGG + Intergenic
1141826540 16:86484624-86484646 TCACCTCCAAGTCCTCTTTCTGG - Intergenic
1141926117 16:87170721-87170743 TCACTTCCATGCATTCTTTTTGG + Intronic
1145917506 17:28584146-28584168 TTACCTCCAAGGTCTCTTTCAGG + Exonic
1150200668 17:63353776-63353798 TCACCTCAATGCACTTTTTTTGG - Intronic
1151100537 17:71550990-71551012 TCACTTCCATGCCTGCTTTATGG + Intergenic
1151616985 17:75219801-75219823 TCACCTCCAATCTCTCATGAGGG - Intronic
1156343075 18:36229831-36229853 TCACCTCCATGATTTCTATCTGG + Intronic
1159142122 18:64409874-64409896 TTACCTCCATGTTCTATTCAGGG - Intergenic
1160922304 19:1526714-1526736 TCACCTCCATGTTCTTGTTAAGG - Exonic
1162189336 19:8932486-8932508 TGACCTCCATGTTCTCTCCAAGG - Intronic
1165807977 19:38593404-38593426 CCAGCTCCTTGCTGTCTTTAAGG - Intronic
1166861826 19:45815741-45815763 TCACCTCCACGCTCCCCTTCAGG + Intronic
1167344979 19:48939633-48939655 TCACCTCCATGGTCTTTGGAGGG + Exonic
1168402135 19:56091552-56091574 GCCCCTCCATGCACTCTTTGGGG - Intronic
1168436925 19:56325464-56325486 TGACCTCCCTGTTCTCTTTCAGG - Intronic
927023661 2:19043356-19043378 TCCCCTTCATGCTTTCTATAGGG + Intergenic
927573841 2:24183936-24183958 TCACCTCCTTGCTCTCCCTGTGG + Intronic
928873903 2:36014325-36014347 TCATTTCCCTCCTCTCTTTATGG - Intergenic
935545227 2:104394252-104394274 TCACCTTCCTGCTTTCTTTAAGG + Intergenic
936243024 2:110804785-110804807 TCACCTACTTTCTCTCTCTATGG - Intronic
936941627 2:117890084-117890106 TCATCTCCATGATCTGTTTTTGG + Intergenic
939228899 2:139400596-139400618 TCACCTCCATGTTTTATTTGTGG - Intergenic
939787114 2:146529232-146529254 TCACATCCTTGTTCTCCTTATGG - Intergenic
943766001 2:191663328-191663350 TCACCACCATGCTTTCCTTCTGG + Intergenic
1176303980 21:5113982-5114004 TGACCTCCAGGCTCTCTTGAAGG - Intergenic
1177323223 21:19548590-19548612 TCACTTCTATGATCACTTTAGGG - Intergenic
1178304718 21:31481884-31481906 TCAGCTCCATCCTCTCCTTAGGG - Intronic
1178897845 21:36575083-36575105 TCTCCTCTATTCTCTTTTTATGG + Intronic
1179853050 21:44147968-44147990 TGACCTCCAGGCTCTCTTGAAGG + Intergenic
1179980652 21:44894117-44894139 TCACCTGCATCCTCTGTGTAAGG + Intronic
1180984057 22:19893675-19893697 TCACCTTCTTGCTCTCTGTCAGG - Intronic
950519521 3:13488454-13488476 TCACCTGCATTCTCTCTCTATGG + Intronic
951098128 3:18655218-18655240 TATCCTCACTGCTCTCTTTAAGG - Intergenic
952271243 3:31834004-31834026 TCACATCCATGCCTTCTTTCAGG + Intronic
952874938 3:37936718-37936740 TCAACTCTATGATTTCTTTAAGG + Intronic
953460415 3:43077494-43077516 TCACCTCTGTGCTTTCTGTATGG - Intergenic
953740890 3:45538101-45538123 TCGCCTCCTTGCTCATTTTAGGG - Intronic
955083288 3:55677597-55677619 TCCCCTCCATTTTCTCTTTGAGG - Intronic
956274775 3:67486639-67486661 GCACCTGTATGCTCTCTGTAGGG + Intronic
956723452 3:72138121-72138143 TCATTTCCAGGCTCTCTGTAGGG + Intergenic
957079417 3:75623673-75623695 TCACCTTCATCCTCTTTTTCTGG - Intergenic
958919576 3:100089467-100089489 TCATCTCCATCTACTCTTTAGGG - Intronic
960621132 3:119637815-119637837 TCACCCCCATACTCTTCTTAAGG - Intronic
961823409 3:129586692-129586714 CCACCTGCATGCTCTCGTTCAGG + Exonic
962153752 3:132921962-132921984 TCATCTCCATGCTTTCTGTAAGG + Intergenic
965198264 3:165625880-165625902 TCACCTGCATGCTCCCATAAGGG - Intergenic
965916135 3:173848363-173848385 TCATATCTCTGCTCTCTTTAAGG - Intronic
966750638 3:183318260-183318282 TCACCAACATGCTGTCTTGATGG + Intronic
967679061 3:192338512-192338534 ACACCTTTATGCTGTCTTTAAGG - Intronic
968357545 3:198120951-198120973 TCACCTCCATCTTCTTTCTATGG + Intergenic
969022500 4:4147618-4147640 TCACCTTCATCCTCTTTTTCTGG - Intergenic
969416921 4:7067082-7067104 TCACCTGCCTGCTCTCCTTCAGG + Intronic
969731385 4:8959782-8959804 TCACCTTCATCCTCTTTTTCTGG + Intergenic
969790988 4:9493890-9493912 TCACCTTCATCCTCTTTTTCTGG + Intergenic
976339829 4:83934699-83934721 TCACCTTCATCCGCTCTTTCAGG - Intergenic
976513229 4:85934402-85934424 TCAACTTTATGCTCTCTTCAAGG + Intronic
977116539 4:93035648-93035670 TCACTTCCATACTCACTTTGTGG + Intronic
977329316 4:95617467-95617489 TCACCTACTTGTTCTCTTTTGGG + Intergenic
980531213 4:134057616-134057638 TCACCTTAATGCTCCCTTCAGGG - Intergenic
983280820 4:165679077-165679099 TAACCTCCAAGGTCTCTTCAAGG - Intergenic
984885026 4:184442315-184442337 TCACCTCCATGCTCTCTTTAAGG + Intronic
985063124 4:186097651-186097673 GCACCTCTATGCTCTGTTAATGG - Intergenic
985888408 5:2697672-2697694 TTCCCTCCATGCTCTGTTTTGGG - Intergenic
986607758 5:9539147-9539169 TCACCTGCCTGCCATCTTTATGG + Intronic
989121335 5:38007562-38007584 TTACCTCCATGCTCTTCTTGTGG - Intergenic
993787093 5:92155874-92155896 TCAACTGTATGCTGTCTTTAAGG - Intergenic
995219547 5:109632688-109632710 TCATTTCCATGCCCTCTTCAGGG + Intergenic
996769310 5:127069176-127069198 TCATCTTAATGCTATCTTTATGG - Intronic
997262873 5:132477464-132477486 TCACCTGCAGGCTTCCTTTAGGG - Intergenic
998186295 5:139982350-139982372 CCACCTCCCTGCCCTCTTTACGG + Intronic
999131122 5:149284148-149284170 TCACCTCCATCTGCTCTTTTGGG - Intronic
999439530 5:151590788-151590810 TCTCCTCCATGTCCTCTTAAAGG + Intergenic
1007394334 6:41569107-41569129 TCACCTCCACGCTGTCTTTGGGG + Intronic
1007866337 6:44973875-44973897 TTACCTCCATGCTGTTTTCATGG - Intronic
1009976228 6:70674036-70674058 TTGAATCCATGCTCTCTTTAAGG + Intronic
1012011345 6:93790005-93790027 GTACCTCCATGCTTTCTTTGTGG + Intergenic
1012548018 6:100441366-100441388 TCCCCTCCATTCTCTCTCAAAGG + Intronic
1015433915 6:133163840-133163862 TTCCCTCCATGCTATCTTAATGG + Intergenic
1015855393 6:137618725-137618747 TTGCCTTCATGCTCTCTTTCAGG + Intergenic
1016707277 6:147124245-147124267 TCAACTATATGCTCTATTTAAGG + Intergenic
1017082244 6:150681127-150681149 TAACTCCCATGCTGTCTTTACGG - Intronic
1018645941 6:165948636-165948658 TCACCTCGATGGTTTCTTGATGG - Intronic
1019141624 6:169950384-169950406 TCACCTGCCAGGTCTCTTTATGG - Intergenic
1020309912 7:6859654-6859676 TCACCTTCATCCTCTTTTTCTGG - Intergenic
1022009114 7:26293080-26293102 TCACCTCCATTCTCTCACTGAGG - Intronic
1023496125 7:40799158-40799180 TCAGCTCCAGGATCTCTTCATGG - Intronic
1025239312 7:57257881-57257903 TGAGCCCCATGCTCTCTTTCAGG - Intergenic
1028619861 7:92813253-92813275 TCACCTCCATCTTCTTTTCACGG - Intronic
1029393523 7:100290993-100291015 TCCCCTCCATGCTGTTTTCATGG + Intergenic
1031941306 7:127792519-127792541 TTACCTCCATGCTACCCTTAGGG - Intronic
1034867318 7:154652961-154652983 TCACGTCCATTCATTCTTTAAGG + Intronic
1036775377 8:11608417-11608439 TGGCTGCCATGCTCTCTTTATGG - Intergenic
1038582401 8:28760198-28760220 TAACCTCTATTCTCTCTCTATGG + Intergenic
1041531540 8:58873859-58873881 TCTCCTCCATAATCTATTTAAGG + Intronic
1043918854 8:85957838-85957860 TCTCCTCCATGTTCTCTTCTAGG + Intergenic
1047268944 8:123336369-123336391 TCACCTCCAGGATCTCTATCTGG + Exonic
1050820486 9:9872809-9872831 TCTCCTCCATCTTCTCTTGAAGG - Intronic
1051327027 9:15982965-15982987 TAACATCCATTCTCTCTTAAAGG + Intronic
1053202356 9:36161484-36161506 TTTCCTCTAAGCTCTCTTTAGGG - Intronic
1053564912 9:39239109-39239131 TGACCTCCATTCTCTCTCCAAGG + Exonic
1053577309 9:39365458-39365480 TCACATCCATCCATTCTTTAGGG + Intergenic
1053830689 9:42076985-42077007 TGACCTCCATTCTCTCTCCAAGG + Exonic
1053841808 9:42193383-42193405 TCACATCCATCCATTCTTTAGGG + Intergenic
1054132238 9:61379930-61379952 TGACCTCCATTCTCTCTCCAAGG - Intergenic
1054587476 9:66982785-66982807 TCACATCCATCCATTCTTTAGGG - Intergenic
1054599870 9:67110452-67110474 TGACCTCCATTCTCTCTCCAAGG - Intergenic
1055015502 9:71613384-71613406 TCACACTCATGGTCTCTTTATGG + Intergenic
1055169025 9:73232066-73232088 TTACCTCTATTCTCTCTTGAAGG + Intergenic
1057013768 9:91632277-91632299 TCACCTCCTGGCTTTCTTAATGG - Intronic
1057829224 9:98394241-98394263 TCACCTCCCTGCTGTCTGTGGGG + Exonic
1059045247 9:110859921-110859943 ACACATCAATGCTTTCTTTATGG - Intergenic
1060962156 9:127688813-127688835 TCACCTACGTGGTTTCTTTAAGG - Intronic
1061624513 9:131833829-131833851 TCACTTCCATGCACACTTCATGG - Intergenic
1062151063 9:135019302-135019324 TCAGCTCCCTGGTCTATTTAGGG - Intergenic
1187002283 X:15194647-15194669 TCTTCTCCATTCTCTCTTTCAGG + Intergenic
1187827115 X:23342785-23342807 TGCCCTCCCTCCTCTCTTTAAGG + Intronic
1188999785 X:36931486-36931508 TAACCTCCAAGCTGTCTTTGTGG - Intergenic
1190224016 X:48531795-48531817 TCACACCCATGATCTCTTTGTGG + Intergenic
1191103955 X:56760773-56760795 TCACCTACATGGTCACTTTGGGG + Intergenic
1191111145 X:56803885-56803907 CCACCTACATGGTCTCTTTGGGG + Intergenic
1193642611 X:84029400-84029422 TCTCCTCTATGTTCCCTTTAGGG - Intergenic
1194454340 X:94083405-94083427 TCACCTCAAAGTTTTCTTTAAGG + Intergenic
1196070780 X:111519125-111519147 TCACCTTCATCCTGGCTTTAGGG - Intergenic
1197644024 X:128998052-128998074 TCACTTCCATGATCCTTTTATGG - Intergenic
1199227418 X:145394164-145394186 TCAGCCCCATGCTCTCTGCATGG + Intergenic
1199312992 X:146343534-146343556 TCTCCTCCATTCATTCTTTAAGG - Intergenic
1200130750 X:153843315-153843337 TCATCTCCTTGCTGTCTCTATGG + Intergenic
1201306804 Y:12557315-12557337 TTACCTCCAAACTCTTTTTAAGG - Intergenic
1201917875 Y:19202301-19202323 TAATCTCCATGCACTCTTGATGG - Intergenic