ID: 984886212

View in Genome Browser
Species Human (GRCh38)
Location 4:184452086-184452108
Sequence GTCTCCAAATAGAGGTGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 129}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984886212_984886216 -3 Left 984886212 4:184452086-184452108 CCTTCACACCTCTATTTGGAGAC 0: 1
1: 0
2: 1
3: 10
4: 129
Right 984886216 4:184452106-184452128 GACCCTCCTCAGGTGATGTAGGG No data
984886212_984886220 4 Left 984886212 4:184452086-184452108 CCTTCACACCTCTATTTGGAGAC 0: 1
1: 0
2: 1
3: 10
4: 129
Right 984886220 4:184452113-184452135 CTCAGGTGATGTAGGGACCCAGG 0: 1
1: 0
2: 2
3: 17
4: 191
984886212_984886221 9 Left 984886212 4:184452086-184452108 CCTTCACACCTCTATTTGGAGAC 0: 1
1: 0
2: 1
3: 10
4: 129
Right 984886221 4:184452118-184452140 GTGATGTAGGGACCCAGGCCAGG 0: 1
1: 0
2: 0
3: 25
4: 202
984886212_984886215 -4 Left 984886212 4:184452086-184452108 CCTTCACACCTCTATTTGGAGAC 0: 1
1: 0
2: 1
3: 10
4: 129
Right 984886215 4:184452105-184452127 AGACCCTCCTCAGGTGATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984886212 Original CRISPR GTCTCCAAATAGAGGTGTGA AGG (reversed) Intronic
902221205 1:14967021-14967043 GTCTGCACATGGAGGTGGGAAGG + Intronic
902500497 1:16907962-16907984 GTCTCCTGATAAAGGTGGGATGG + Intronic
904926726 1:34055263-34055285 GTAACCAAATGGAGGTGGGATGG + Intronic
906582300 1:46946225-46946247 GACTCCAAAAAGGGATGTGATGG - Intergenic
910581108 1:88825948-88825970 GTCAGCAAATAGAGTTGGGATGG - Intronic
914517078 1:148383192-148383214 GTCTCCTGATAAAGGTGGGATGG - Intergenic
917631946 1:176898992-176899014 TTCTGCAAACAGAGGTGGGAGGG - Intronic
923859603 1:237880017-237880039 GCCTCCAAAAAGAGGTTTAATGG + Intronic
1063433695 10:6013515-6013537 GACTCCAAGCAGAGGTGTGCTGG + Intronic
1067083167 10:43223275-43223297 GTCCCCAAATAGAAGTGTGCAGG + Intronic
1067282217 10:44881120-44881142 TCCCCCAGATAGAGGTGTGAGGG - Intergenic
1068005410 10:51387481-51387503 ATCTCTAAAAAGAGGTGTGATGG - Intronic
1068219263 10:54022883-54022905 TCCTTCAAATAGAGGTGTGTGGG - Exonic
1069858419 10:71454687-71454709 GTCTCCAAAAAGAGGAGGGGTGG + Intronic
1071373777 10:84981818-84981840 GTCTGCAAATAGAAGCTTGAAGG - Intergenic
1077875520 11:6301876-6301898 GTTTCCAAAAAGAAGGGTGATGG - Intergenic
1078636373 11:13054299-13054321 GTGTCCAGATATACGTGTGAGGG + Intergenic
1082036391 11:47648606-47648628 GTCTCCAGATACAGGGGTCAAGG - Intergenic
1083870063 11:65481687-65481709 GTCTCCATATAGGGATGTGGTGG + Intergenic
1083885496 11:65571563-65571585 GCCTCCAAATACAGATGTCATGG + Exonic
1088211704 11:107464370-107464392 GGCTCCAAATAAAGGGATGAAGG - Intergenic
1091353606 11:134916743-134916765 GTCTCCAAATAGACTTGGGAAGG + Intergenic
1101613711 12:106315712-106315734 GGCTCCAACTAGAGGTCGGAGGG - Intronic
1104413507 12:128578958-128578980 GACTCCAAATAGAGGTGACTAGG + Intronic
1107325586 13:39238897-39238919 GGCTCAAAATAGAGGGATGAAGG - Intergenic
1111519466 13:89381436-89381458 GTCTCCAAATACAGTTGTATTGG - Intergenic
1113292971 13:108926072-108926094 GTTTCCAAATGGAGGTCTGGAGG - Intronic
1113856251 13:113447728-113447750 GTCTCATAGGAGAGGTGTGAGGG + Intronic
1118468577 14:66054085-66054107 GTCTCAAAATACAGGTGAGGTGG + Intergenic
1122539828 14:102491937-102491959 GCCTCCAATTAGAGGTGTCCAGG + Intronic
1124421163 15:29524226-29524248 TTCTCCAAAAAGAGATTTGAAGG + Intronic
1127721218 15:61701881-61701903 GTCTTCAAATAGAACAGTGAGGG + Intergenic
1128494326 15:68184614-68184636 GTCTGCAAATGCAGATGTGAAGG + Intronic
1129304070 15:74645870-74645892 GTCTCAAAAAAGAGTTGGGAAGG + Intronic
1130666597 15:85874571-85874593 GGCTCCATATAGAAGTCTGAGGG - Intergenic
1131287532 15:91074169-91074191 ATCTCCATATAGAGGGATGAGGG - Intergenic
1131288733 15:91085957-91085979 GTGTTCACACAGAGGTGTGATGG + Intergenic
1131796629 15:96024320-96024342 CTCTCCAACTAGAAGTATGATGG - Intergenic
1133349119 16:5089878-5089900 GTCTCCAAAAAGAGGGCTGTGGG + Intronic
1133662059 16:7927795-7927817 GTCTCCAAAGACAATTGTGAAGG - Intergenic
1142674756 17:1506888-1506910 GTCTCAGAATAGAAGTGTTAGGG - Intronic
1143063977 17:4228822-4228844 TCCTCCAAATTGAGGTGTAATGG - Intronic
1144454228 17:15405946-15405968 GACTCCAAATAGAAGCATGAAGG + Intergenic
1149607252 17:57933802-57933824 GGCTCCAAATAGAGGTGTTCTGG - Intronic
1151553958 17:74837298-74837320 GTCCCCAGATAGAGCTGCGAGGG + Exonic
1151672410 17:75578630-75578652 GTCTGCAGATTGAGATGTGAGGG + Intergenic
1155459850 18:26066379-26066401 GACTTCAAATGGAGATGTGAAGG - Intronic
1165782911 19:38444178-38444200 GCCTCCAAGCAGAGGTCTGAAGG + Exonic
926968799 2:18445450-18445472 GTCTCCAAATACTTGAGTGAGGG + Intergenic
930262656 2:49165706-49165728 GGCTTCAAACACAGGTGTGATGG + Intergenic
930668498 2:54123397-54123419 TTCTACAAATAGAGGTAGGAAGG + Intronic
939503312 2:143012861-143012883 GTTACCAAAGACAGGTGTGAGGG - Intronic
944757617 2:202780382-202780404 GTCTCCATAAGGAGATGTGAGGG - Intronic
948084233 2:235232976-235232998 CTCTCCAAATAGCTGTGAGAGGG - Intergenic
948475238 2:238214097-238214119 GTCTCCAAAAAAGGGTGTGGGGG - Intergenic
948687966 2:239682692-239682714 GACTCCAGATAGAAGTGTGTTGG + Intergenic
1170043004 20:12058220-12058242 TTGTCCAAATAGAGCTGTGGGGG + Intergenic
1170859192 20:20086966-20086988 GGCTAGAAATAGAGGTGGGAAGG + Intronic
1170949975 20:20927563-20927585 GGCTCCAAATAGTGGTGGGATGG + Intergenic
1171246977 20:23619205-23619227 GGCTCAAAATAAAGGCGTGAAGG - Intergenic
1174461799 20:50688596-50688618 GTCCCCAGACAGAGGTGTGCTGG - Intronic
1175438862 20:58976470-58976492 TTCTCCAAACAGCAGTGTGATGG - Intergenic
1176379868 21:6106901-6106923 GTCCCCAGAGAGAGGTGAGACGG - Intergenic
1178901940 21:36605535-36605557 GTCCCCAGATAGTGTTGTGAAGG + Intergenic
1179743606 21:43431336-43431358 GTCCCCAGAGAGAGGTGAGACGG + Intergenic
1183944518 22:41317416-41317438 GTCTCCAAATATAGGGTTTAGGG + Intronic
952690637 3:36201056-36201078 GTCTCCAAATAGAGTTATATTGG + Intergenic
952926008 3:38319553-38319575 GTCTCCAAAGTGGGGTTTGAAGG + Intergenic
958634118 3:96720873-96720895 GTCTTTTAATAGAGGAGTGAAGG - Intergenic
958918472 3:100075965-100075987 GTCTTCAAAGTGAGGTCTGAGGG - Intronic
962499110 3:135971295-135971317 GTTTCCAAAAAGTTGTGTGAAGG + Intronic
963231558 3:142913579-142913601 GTCTCCAAACACAGGTATGTCGG - Intergenic
964071383 3:152637797-152637819 GTTTCCATTCAGAGGTGTGATGG + Intergenic
964861201 3:161203665-161203687 CACTACAAATAGAGGTGTGCTGG + Intronic
966214087 3:177483392-177483414 GTCTCTAAATACAGATGTCATGG - Intergenic
966291419 3:178363393-178363415 GGCTCCAAATAAAGGGGTGGAGG + Intergenic
966952476 3:184834364-184834386 ATCTCCTAAAAGAGGTATGACGG - Intronic
967526200 3:190495968-190495990 GTCACAAAATAGCTGTGTGACGG - Intergenic
968947012 4:3670481-3670503 GTCGCTTAATAGATGTGTGACGG - Intergenic
969624083 4:8293628-8293650 GTCTCCAAAGAGAGGGATGGGGG + Intronic
972245980 4:37245408-37245430 GTGTCCTAATAGAAGTGTGCAGG - Intronic
973717174 4:53688465-53688487 ATCTACAAACAGAGGGGTGATGG - Intronic
975364763 4:73516693-73516715 GTCTCAAAATAAAGGGATGAAGG - Intergenic
975475886 4:74822828-74822850 CTTTGCAAATAGAGGTGTGGGGG + Intergenic
976062580 4:81146220-81146242 TTTTCTAAATAGAGGTGAGATGG + Intronic
977502775 4:97862176-97862198 GGCTCAAAATAAAGGTGAGATGG - Intronic
978164508 4:105590439-105590461 GTGTTCAAATAGATGTCTGAGGG - Intronic
978233598 4:106430564-106430586 ATCTCCAAGCAAAGGTGTGATGG + Intergenic
978314301 4:107418538-107418560 ATCCCCAAATGGATGTGTGATGG + Intergenic
980044765 4:127975080-127975102 GTCTCCAAATAAAATTTTGAGGG - Intronic
981103177 4:140853192-140853214 GTGTCCAGATAGAGGTGAGTGGG + Intergenic
981650660 4:147054199-147054221 GTCTCCCACTGGAGGTGAGATGG + Intergenic
984597087 4:181682462-181682484 GTCTACATATAGAGGGGTCATGG - Intergenic
984886212 4:184452086-184452108 GTCTCCAAATAGAGGTGTGAAGG - Intronic
986421327 5:7586889-7586911 ATCTACAAATAGAGATCTGAAGG - Intronic
986474371 5:8112062-8112084 GTCTCCAAATTGAGCTGTATGGG - Intergenic
989181924 5:38587070-38587092 CTCTCCAAATGGATGAGTGAAGG - Intronic
993676827 5:90825297-90825319 GACTCCAACTAGAGGTTTCATGG - Intronic
994014099 5:94945203-94945225 GTTTCCAACTAGTGGTGGGAAGG - Intronic
995547704 5:113249451-113249473 GTCTCCACAGAAAGCTGTGAAGG - Intronic
996402131 5:123074138-123074160 GACTCCAAAGAGCTGTGTGAGGG + Intergenic
1001236118 5:170031046-170031068 GGCTCCAAAGAGAGCTCTGAGGG - Intronic
1002382092 5:178838500-178838522 GTCTCCAATTACAGGGGTAAGGG + Intergenic
1002467686 5:179416000-179416022 GTCTGCAAAGAGAGGTGGGATGG + Intergenic
1007174808 6:39888462-39888484 GTGTCAAAATAGAGACGTGAGGG - Intronic
1007634857 6:43293218-43293240 GTGGTCAAAGAGAGGTGTGAGGG + Intergenic
1009778691 6:68240218-68240240 GTCTACAAATGGAGGTGTGTGGG - Intergenic
1011442802 6:87405077-87405099 GTCTTAAAATAGAATTGTGATGG - Intergenic
1011834604 6:91416159-91416181 GACACCAAATGAAGGTGTGATGG + Intergenic
1015004155 6:128257824-128257846 GTTTTCAAAGATAGGTGTGATGG + Intronic
1015244239 6:131059894-131059916 GTTTCTAAATAAAGGTGGGATGG + Intronic
1020608397 7:10365595-10365617 GGCTCAAAATAAAGGTGTGAAGG - Intergenic
1022031545 7:26495894-26495916 GTCTCCAAATAGCTGGATGATGG + Intergenic
1022315727 7:29243852-29243874 ATCTAAAAATAGAGTTGTGATGG - Intronic
1022516551 7:30978340-30978362 GTTTCCACAGAGAGGTGTGAAGG + Intronic
1022569871 7:31441741-31441763 GTCTCCAAGTAGACGTGGGTGGG - Intergenic
1024520026 7:50297421-50297443 GCCTCCAAGTAAAGGTGTTAAGG + Intergenic
1030799308 7:113829636-113829658 CTCTCCAAAAAGAATTGTGAGGG + Intergenic
1032658455 7:133956123-133956145 GTCTCCAAATGAAGTTGTAATGG + Intronic
1035836374 8:2757609-2757631 GTCTCCAAAGAGAGGAGGGAAGG + Intergenic
1038389629 8:27183342-27183364 GTCTCCAGTTAGAGGTGAGTTGG - Intergenic
1041179892 8:55236441-55236463 CTTTCCAAATGCAGGTGTGAAGG + Intronic
1044702892 8:94980368-94980390 GTATCCCAAGAAAGGTGTGACGG + Intronic
1045022327 8:98054512-98054534 GTCTCCAAAGAGAGGTAGAATGG - Intergenic
1046702512 8:117417661-117417683 GCCTCCAATTAGAACTGTGATGG + Intergenic
1048901926 8:139047026-139047048 GTCTCCAAAAAGAGGAAGGAAGG - Intergenic
1051130305 9:13852932-13852954 GTTTCTAAATAAAGGTGTGGGGG + Intergenic
1051588199 9:18749184-18749206 GTCTCCAAAAAAAGGTATGTTGG - Intronic
1054904593 9:70403517-70403539 GTCTCCAAATAGTGGTGAGATGG - Intronic
1056102177 9:83310519-83310541 GTCTGCAAATTGAAGTTTGAAGG - Exonic
1061032770 9:128096559-128096581 ATCTGCAAATAGAGTTGTCAGGG - Intronic
1061267548 9:129515787-129515809 GTCTCAAAAAAAAGGTGTGTGGG - Intergenic
1061465198 9:130772859-130772881 GTCTTCAAACACAGGTATGAGGG + Intronic
1185670357 X:1804609-1804631 GTCTCCAAATACAGTCGTAATGG - Intergenic
1193776555 X:85649659-85649681 GGGGCCAAAGAGAGGTGTGATGG - Intergenic
1194961780 X:100244475-100244497 GTGTTTAAATAGAGGTGAGATGG - Intergenic
1195268461 X:103207087-103207109 GTAACCAAAAAGAGGTGGGAAGG - Intergenic
1196110490 X:111941779-111941801 GTCTCAAGATAGTGCTGTGAGGG + Intronic
1196340275 X:114586641-114586663 ATCTCCATCTAGAGGTGTCATGG + Intronic
1197565107 X:128074125-128074147 GGCTCAAAATAGAGGGCTGAAGG + Intergenic
1201922398 Y:19247526-19247548 GTCTCCAAATAAAGGGATGGAGG + Intergenic