ID: 984887521

View in Genome Browser
Species Human (GRCh38)
Location 4:184463856-184463878
Sequence CTACTGTCATTCTCCAACAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 126}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984887521 Original CRISPR CTACTGTCATTCTCCAACAG GGG Intronic
901369598 1:8785524-8785546 CTGGTTCCATTCTCCAACAGAGG + Intronic
901884114 1:12210764-12210786 CTCCTGTCTTTCTCCCTCAGTGG + Intergenic
911943347 1:104074276-104074298 CTAATGTCATTTTCCAAGATGGG - Intergenic
916568153 1:166000548-166000570 GCACTGTGATTCTCCAAGAGAGG + Intergenic
921111055 1:212037076-212037098 GTACTGTCACTCTTAAACAGAGG - Intronic
1068083077 10:52344329-52344351 CTTCTGTCATTCTCAATAAGAGG - Intergenic
1069809693 10:71149050-71149072 CCTCAGTCATTCTCCATCAGTGG + Intergenic
1072154520 10:92712569-92712591 CTCCTGTCAGTCTCCTACACTGG + Intergenic
1072917670 10:99549324-99549346 GTACTGTCATTTTCCATCAGAGG - Intergenic
1073243522 10:102073743-102073765 CTCCTGTAATTCCCAAACAGAGG + Intergenic
1075672119 10:124269995-124270017 CTGCTCTCCTTCTCCAGCAGAGG + Intergenic
1080000429 11:27342268-27342290 TTACTCTCATTCTAAAACAGGGG + Intronic
1080895282 11:36443893-36443915 CTACTGTCTTACACCAACTGGGG - Intronic
1082132401 11:48506382-48506404 CTAGTTTCATTCTCCTACATAGG - Intergenic
1086751840 11:90505938-90505960 CTACAGGCATTCCCAAACAGAGG - Intergenic
1087494781 11:98877219-98877241 GTACTGTGAATCACCAACAGGGG + Intergenic
1091853434 12:3719473-3719495 CTCCTTTCATGCTCCAAAAGAGG + Intronic
1091980974 12:4863550-4863572 CCACTCTCATCCTCCAACACTGG - Intergenic
1093528626 12:20135238-20135260 CTACGGTAATTCTCCAAAAAGGG - Intergenic
1094803053 12:34060492-34060514 CTAATGCCATTCTCCAATAAGGG + Intergenic
1095660563 12:44729081-44729103 ATACTATAATACTCCAACAGTGG + Intronic
1095698145 12:45164081-45164103 CTGCTGTAGTTCTCCAACAAGGG - Intergenic
1098038215 12:66328072-66328094 TTCCTGTCAGTCTCCCACAGTGG - Intronic
1098062258 12:66575148-66575170 CAACTGACATTCTCCCTCAGAGG + Intronic
1100799943 12:98220603-98220625 CAACTGCCACTCTCGAACAGCGG + Intergenic
1106448655 13:29860064-29860086 CTGCAGCCATTCTCCAACTGTGG - Intergenic
1106601112 13:31187731-31187753 CTTCTTTCTTCCTCCAACAGAGG - Intergenic
1106870283 13:34011836-34011858 CTCCTGTCAGTGTCCAAAAGAGG + Intergenic
1107063707 13:36189018-36189040 CTACTGTCCTTCTTCGTCAGTGG + Intronic
1108263978 13:48685943-48685965 GTACTGTGACTCTCCAAGAGGGG + Intronic
1110839652 13:80127445-80127467 TTACTATTATTATCCAACAGTGG - Intergenic
1111239450 13:85455917-85455939 CTCCTTTCATTCTCCTACACTGG - Intergenic
1111753397 13:92362440-92362462 CTCCTTTCAGTCTCCAACAAGGG + Intronic
1116296836 14:43121468-43121490 CTAATGCAGTTCTCCAACAGAGG + Intergenic
1116508669 14:45716690-45716712 TAACTTTCATTCTCCAGCAGGGG + Intergenic
1120093963 14:80366669-80366691 CTAATACCATTCTCCAACAATGG + Intronic
1122044168 14:99011612-99011634 CCACTGTGACTCTCCAAGAGGGG + Intergenic
1123854192 15:24390455-24390477 CTAATGTCATTCACCAAAAAAGG - Intergenic
1126078270 15:44934057-44934079 CCACTATCATTCTCCAATATCGG - Intergenic
1126079782 15:44948706-44948728 CCACTATCATTCTCCAATATCGG + Intergenic
1131183677 15:90257511-90257533 CTCCTGTCTCTCTCCACCAGAGG - Intronic
1140037893 16:71384987-71385009 CAAATGTCATTCTCCACCGGTGG + Intronic
1148006225 17:44432415-44432437 CAGCTGTCATTCTCAAACATTGG - Intronic
1153940743 18:9974343-9974365 TTACTACCATTCTCCAAAAGCGG + Intergenic
1154077215 18:11215161-11215183 CTACTGTAGTTCTTCAAAAGTGG - Intergenic
1157877887 18:51290551-51290573 CTGCTGTGATTCTCCTCCAGTGG + Intergenic
1160412190 18:78682799-78682821 CCACTGTCATTGTGCAACATCGG + Intergenic
1165175099 19:33923199-33923221 CTACTAACATACTGCAACAGTGG + Intergenic
1165641016 19:37386715-37386737 CTACAGTTATTTTCCAACATGGG - Intronic
1167093141 19:47358397-47358419 CTGCTTTCATGCTGCAACAGTGG - Intronic
1167413666 19:49359790-49359812 TTACTGTCATTATTCATCAGTGG + Intronic
1168445369 19:56407041-56407063 ATACTGTCCCTCTCCCACAGAGG + Exonic
925589841 2:5498556-5498578 CCACTGTTATTCTACAACAGAGG + Intergenic
927619522 2:24638016-24638038 TTACTGTAGTTATCCAACAGTGG + Intronic
931596880 2:63956782-63956804 CCACCGCCATTCTACAACAGAGG - Intronic
931842925 2:66173497-66173519 CTAATGGCATTTTCCAGCAGAGG + Intergenic
932793129 2:74673104-74673126 GTACTGTGACTCTCCAAAAGGGG - Intronic
934543933 2:95199202-95199224 CCTCTGTCATTCTCCCCCAGGGG + Intergenic
936932321 2:117802865-117802887 CTAAACTCATTCTCCAAAAGTGG + Intergenic
939941445 2:148356420-148356442 CTACTGTCACTCTCCCCCACTGG + Intronic
940583814 2:155617397-155617419 CTACTGTCAGTGTCTAACATTGG - Intergenic
942080713 2:172397141-172397163 TTACTGGCATTCTCACACAGGGG + Intergenic
942389581 2:175478111-175478133 CTTCTGTCATTAACCATCAGTGG - Intergenic
942872338 2:180750028-180750050 ATACTGCCAATCTCCAAAAGAGG - Intergenic
947712431 2:232323768-232323790 CTGCTGCCAGTCTCCAGCAGAGG - Intronic
947719820 2:232363583-232363605 CTGCTGCCAGTCTCCAGCAGAGG - Intergenic
947731390 2:232433448-232433470 CTGCTGCCAGTCTCCAGCAGAGG - Intergenic
1172570138 20:35963769-35963791 CTACTGACATGTTTCAACAGAGG - Intronic
950865206 3:16183217-16183239 AGCCTGTCATTCTCCATCAGTGG - Intronic
952708844 3:36408356-36408378 TTATTGTCATTCTCCACCAGGGG + Intronic
952956792 3:38562581-38562603 CTACTGTCTGTCCCCAACAGTGG - Intronic
955016329 3:55073665-55073687 CTACTCTCTCTCTCCAACAGTGG - Intronic
955227793 3:57075282-57075304 CTACTGTCCATCTCCACCACTGG + Exonic
955542346 3:59990791-59990813 CTACTGGCATTTTAGAACAGAGG + Intronic
955811316 3:62793532-62793554 GTACAGTCATTTTCCAGCAGTGG - Intronic
957273577 3:78062322-78062344 TTACTGTCCCTCTCCTACAGAGG + Intergenic
959009153 3:101054455-101054477 CTGCTGTTATTTTCCAACATAGG + Intergenic
960459634 3:117917727-117917749 CTCCTGTGATTCTCCACCTGAGG + Intergenic
960494758 3:118360859-118360881 CTACTGTGATTCACCTAGAGGGG + Intergenic
964254251 3:154757488-154757510 CTGCTTTCATGCTACAACAGCGG + Intergenic
971453579 4:26822725-26822747 CTACAGTCAATCTGCAACAGCGG + Intergenic
972264479 4:37445853-37445875 CTACTGTCTTTATCAACCAGTGG + Exonic
973258983 4:48141952-48141974 CAACTGTCATTCTTAAACAAGGG + Intronic
973758639 4:54098315-54098337 TTATTGCCATTCTCCATCAGTGG + Intronic
976685920 4:87814871-87814893 CTAGTATCATTCTCCTACATAGG + Intergenic
978771384 4:112459570-112459592 CTTCTGTCATTCTTCCACAAAGG + Intergenic
980458091 4:133070920-133070942 CTACTCTCATTCTCCAACGTTGG + Intergenic
982369364 4:154617553-154617575 CTACAGTTTTTCTCAAACAGGGG - Intergenic
982951467 4:161702468-161702490 ATACAGTCATCCTCCAAAAGGGG + Intronic
983561626 4:169107227-169107249 GTACTGTCATTCTCCAACTAAGG - Intronic
984887521 4:184463856-184463878 CTACTGTCATTCTCCAACAGGGG + Intronic
985235351 4:187867033-187867055 TTACTGTCTGTCTCTAACAGAGG - Intergenic
987907920 5:24103093-24103115 CTATTTCCATTCTCCAACAGTGG + Intronic
988145926 5:27308159-27308181 TTACTGTGATTCTTCAATAGGGG - Intergenic
994138723 5:96318823-96318845 CTAATGTCATTTTCCAGAAGAGG - Intergenic
995891442 5:116956841-116956863 CTACTGTATTTCCCAAACAGTGG - Intergenic
1000960240 5:167592406-167592428 CTACTGTAATTCTCCATTTGTGG + Intronic
1001604378 5:172949571-172949593 CTACCGCCATTCTCAACCAGGGG + Intronic
1004260787 6:14105940-14105962 CCACTATCATTCTTCACCAGAGG + Intergenic
1006119334 6:31794921-31794943 CGGCTGTCCTTGTCCAACAGTGG - Exonic
1011347448 6:86387562-86387584 CTGTTATCATTCTCTAACAGTGG - Intergenic
1011719914 6:90144606-90144628 GGACTGTCATTCTGAAACAGTGG - Intronic
1012971311 6:105734552-105734574 CTACTGACATCCTGCAGCAGTGG + Intergenic
1019060685 6:169255299-169255321 CTCCTGGCATTCCCCCACAGGGG + Intergenic
1020574194 7:9904340-9904362 TTCCTGTCATTTTCAAACAGGGG + Intergenic
1023353244 7:39341066-39341088 CTACTGTCATTCTCAGGCTGGGG - Intronic
1024299724 7:47877661-47877683 CTGCTGTAATTCTCCATCATGGG - Intronic
1025239814 7:57261831-57261853 CTCCTTTCCTTCTCCAACAAAGG + Intergenic
1027729816 7:81857175-81857197 CTATAGTCATTCTCCACCAGGGG - Intergenic
1029871296 7:103695746-103695768 CTGCTGTCATTGTTCAACACTGG - Intronic
1030493726 7:110271007-110271029 TCACTGACATTCTCCAACACAGG + Intergenic
1032059743 7:128714730-128714752 ATGCTGTCACTCTCCAAGAGGGG + Intronic
1035849225 8:2897662-2897684 CTACTGTCATTATTCATCAGGGG + Intergenic
1036043491 8:5113305-5113327 CTATTCCCATTCTCCACCAGTGG - Intergenic
1037446011 8:18966655-18966677 CAACTGTTCTTCTCAAACAGGGG + Intronic
1038784339 8:30597330-30597352 CTACTGTCCCTCTCCTCCAGGGG + Intronic
1039514682 8:38122678-38122700 GTAAGGTCTTTCTCCAACAGTGG + Intronic
1039853220 8:41390042-41390064 CTAATGCCATTCTCCAATAGAGG + Intergenic
1040936860 8:52790540-52790562 CTGCTGACATTCTCCCAGAGTGG + Intergenic
1042963661 8:74328795-74328817 CAACTGTGATTCTTCCACAGGGG - Intronic
1048753738 8:137710465-137710487 TTAACATCATTCTCCAACAGTGG + Intergenic
1048911194 8:139136756-139136778 CTACTTTCATTCTCAAAAGGAGG - Intergenic
1055908390 9:81319423-81319445 CTACGGTCCTTCTGCATCAGGGG - Intergenic
1055984906 9:82048237-82048259 CTATTGTCTTTCTCCAACCTGGG + Intergenic
1057072653 9:92113544-92113566 CTACTGTCAGTCTTCAAAAAGGG + Intronic
1057327988 9:94083807-94083829 CTACTATAACTGTCCAACAGAGG + Intronic
1057656265 9:96955403-96955425 CTACAGCCTTTCTTCAACAGAGG + Intronic
1059722512 9:116975131-116975153 TTCCTGTGGTTCTCCAACAGGGG + Intronic
1186038177 X:5447187-5447209 CCACTGTCAGTCTTCATCAGAGG - Intergenic
1187570070 X:20491855-20491877 CTACTTTCACACTACAACAGCGG - Intergenic
1189877732 X:45454352-45454374 CCACTGTCATTCACAAACAATGG - Intergenic
1194096987 X:89653173-89653195 CTAATACCATTCTCCAACAAAGG - Intergenic
1194939893 X:99997093-99997115 CTAATGGAATTCTCCAACAGGGG - Intergenic
1195345729 X:103949351-103949373 CCACTCTCATTCGCCTACAGTGG - Intronic
1195858503 X:109356198-109356220 CCACTGTCATTCTGAGACAGGGG - Intergenic
1196574654 X:117303945-117303967 CTACTGTTATCATGCAACAGGGG + Intergenic
1197409426 X:126097309-126097331 CCACTGTCCTTCTCCAAGAAAGG + Intergenic
1198000618 X:132431615-132431637 CTAATATCATTCTCCAATAAAGG - Intronic
1200450007 Y:3314553-3314575 CTAATACCATTCTCCAACAAAGG - Intergenic
1202051415 Y:20784658-20784680 CTACTGTCTTTATCCATTAGTGG + Intergenic