ID: 984890341

View in Genome Browser
Species Human (GRCh38)
Location 4:184486460-184486482
Sequence CCAACAGTGAAAGCCTGCCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984890334_984890341 23 Left 984890334 4:184486414-184486436 CCAAAGAGGGTGGATCACGAGGT 0: 22
1: 968
2: 16140
3: 48744
4: 52248
Right 984890341 4:184486460-184486482 CCAACAGTGAAAGCCTGCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984890341 Original CRISPR CCAACAGTGAAAGCCTGCCT CGG Intergenic
No off target data available for this crispr