ID: 984891537

View in Genome Browser
Species Human (GRCh38)
Location 4:184498571-184498593
Sequence AGCAGAATCCTGCTCCTCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984891535_984891537 3 Left 984891535 4:184498545-184498567 CCTGCAGCTGCTGGCTGAGTGCC No data
Right 984891537 4:184498571-184498593 AGCAGAATCCTGCTCCTCACAGG No data
984891533_984891537 23 Left 984891533 4:184498525-184498547 CCGGTGTAAAAACAACAGAGCCT No data
Right 984891537 4:184498571-184498593 AGCAGAATCCTGCTCCTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984891537 Original CRISPR AGCAGAATCCTGCTCCTCAC AGG Intergenic
No off target data available for this crispr