ID: 984893036

View in Genome Browser
Species Human (GRCh38)
Location 4:184510358-184510380
Sequence GCTTTTAAGGGGATCATGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984893028_984893036 -1 Left 984893028 4:184510336-184510358 CCCCAAGGAGTTCTTGGCTGGGG No data
Right 984893036 4:184510358-184510380 GCTTTTAAGGGGATCATGAAGGG No data
984893030_984893036 -2 Left 984893030 4:184510337-184510359 CCCAAGGAGTTCTTGGCTGGGGC No data
Right 984893036 4:184510358-184510380 GCTTTTAAGGGGATCATGAAGGG No data
984893031_984893036 -3 Left 984893031 4:184510338-184510360 CCAAGGAGTTCTTGGCTGGGGCT No data
Right 984893036 4:184510358-184510380 GCTTTTAAGGGGATCATGAAGGG No data
984893020_984893036 14 Left 984893020 4:184510321-184510343 CCCTCAAATCCACCTCCCCAAGG No data
Right 984893036 4:184510358-184510380 GCTTTTAAGGGGATCATGAAGGG No data
984893023_984893036 5 Left 984893023 4:184510330-184510352 CCACCTCCCCAAGGAGTTCTTGG No data
Right 984893036 4:184510358-184510380 GCTTTTAAGGGGATCATGAAGGG No data
984893022_984893036 13 Left 984893022 4:184510322-184510344 CCTCAAATCCACCTCCCCAAGGA No data
Right 984893036 4:184510358-184510380 GCTTTTAAGGGGATCATGAAGGG No data
984893025_984893036 2 Left 984893025 4:184510333-184510355 CCTCCCCAAGGAGTTCTTGGCTG No data
Right 984893036 4:184510358-184510380 GCTTTTAAGGGGATCATGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984893036 Original CRISPR GCTTTTAAGGGGATCATGAA GGG Intergenic
No off target data available for this crispr