ID: 984893767

View in Genome Browser
Species Human (GRCh38)
Location 4:184517104-184517126
Sequence CTGGTTACTTTCCCTTAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984893761_984893767 29 Left 984893761 4:184517052-184517074 CCTTTCAGATAATGAAATGTAAA No data
Right 984893767 4:184517104-184517126 CTGGTTACTTTCCCTTAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984893767 Original CRISPR CTGGTTACTTTCCCTTAGGA GGG Intergenic
No off target data available for this crispr