ID: 984895465

View in Genome Browser
Species Human (GRCh38)
Location 4:184535705-184535727
Sequence TTGAATAATGATGATGATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984895462_984895465 -10 Left 984895462 4:184535692-184535714 CCCCACTTTGATATTGAATAATG No data
Right 984895465 4:184535705-184535727 TTGAATAATGATGATGATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984895465 Original CRISPR TTGAATAATGATGATGATGA TGG Intergenic
No off target data available for this crispr