ID: 984896629

View in Genome Browser
Species Human (GRCh38)
Location 4:184547317-184547339
Sequence AGGTGCACACAGCTGGGACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984896629_984896637 12 Left 984896629 4:184547317-184547339 CCAGGTCCCAGCTGTGTGCACCT No data
Right 984896637 4:184547352-184547374 ACCCCCGCCTCCTTTCTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984896629 Original CRISPR AGGTGCACACAGCTGGGACC TGG (reversed) Intergenic
No off target data available for this crispr