ID: 984900936

View in Genome Browser
Species Human (GRCh38)
Location 4:184585845-184585867
Sequence AGTTTTCCACAGGGGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984900936_984900949 19 Left 984900936 4:184585845-184585867 CCCTCCACCCCCTGTGGAAAACT No data
Right 984900949 4:184585887-184585909 CCCTGGTGTCAAAAAGCTTGGGG No data
984900936_984900943 -5 Left 984900936 4:184585845-184585867 CCCTCCACCCCCTGTGGAAAACT No data
Right 984900943 4:184585863-184585885 AAACTTGTCTTTCACAAAACCGG No data
984900936_984900944 2 Left 984900936 4:184585845-184585867 CCCTCCACCCCCTGTGGAAAACT No data
Right 984900944 4:184585870-184585892 TCTTTCACAAAACCGGTCCCTGG No data
984900936_984900946 17 Left 984900936 4:184585845-184585867 CCCTCCACCCCCTGTGGAAAACT No data
Right 984900946 4:184585885-184585907 GTCCCTGGTGTCAAAAAGCTTGG No data
984900936_984900947 18 Left 984900936 4:184585845-184585867 CCCTCCACCCCCTGTGGAAAACT No data
Right 984900947 4:184585886-184585908 TCCCTGGTGTCAAAAAGCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984900936 Original CRISPR AGTTTTCCACAGGGGGTGGA GGG (reversed) Intergenic
No off target data available for this crispr