ID: 984901265

View in Genome Browser
Species Human (GRCh38)
Location 4:184588727-184588749
Sequence ACTAATACACAGAATGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984901265_984901267 -3 Left 984901265 4:184588727-184588749 CCATCCACATTCTGTGTATTAGT No data
Right 984901267 4:184588747-184588769 AGTAGTTCGTCCTTTTTGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984901265 Original CRISPR ACTAATACACAGAATGTGGA TGG (reversed) Intergenic
No off target data available for this crispr