ID: 984904347

View in Genome Browser
Species Human (GRCh38)
Location 4:184612930-184612952
Sequence CCACCTTAGCACGTGTTGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984904347_984904355 7 Left 984904347 4:184612930-184612952 CCTGACAACACGTGCTAAGGTGG No data
Right 984904355 4:184612960-184612982 ACAGCTTGGTTTTATACTTTGGG No data
984904347_984904353 -7 Left 984904347 4:184612930-184612952 CCTGACAACACGTGCTAAGGTGG No data
Right 984904353 4:184612946-184612968 AAGGTGGGTGGGGCACAGCTTGG No data
984904347_984904354 6 Left 984904347 4:184612930-184612952 CCTGACAACACGTGCTAAGGTGG No data
Right 984904354 4:184612959-184612981 CACAGCTTGGTTTTATACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984904347 Original CRISPR CCACCTTAGCACGTGTTGTC AGG (reversed) Intergenic
No off target data available for this crispr