ID: 984916864

View in Genome Browser
Species Human (GRCh38)
Location 4:184733256-184733278
Sequence TAGGGTGGAAAAGCTGGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 244}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984916864_984916881 29 Left 984916864 4:184733256-184733278 CCTGCTCCAGCTTTTCCACCCTA 0: 1
1: 0
2: 0
3: 25
4: 244
Right 984916881 4:184733308-184733330 AGGCAGCCTTCCCAGGCCCGGGG 0: 1
1: 0
2: 3
3: 33
4: 295
984916864_984916880 28 Left 984916864 4:184733256-184733278 CCTGCTCCAGCTTTTCCACCCTA 0: 1
1: 0
2: 0
3: 25
4: 244
Right 984916880 4:184733307-184733329 CAGGCAGCCTTCCCAGGCCCGGG 0: 1
1: 0
2: 4
3: 68
4: 547
984916864_984916879 27 Left 984916864 4:184733256-184733278 CCTGCTCCAGCTTTTCCACCCTA 0: 1
1: 0
2: 0
3: 25
4: 244
Right 984916879 4:184733306-184733328 CCAGGCAGCCTTCCCAGGCCCGG 0: 1
1: 0
2: 9
3: 85
4: 612
984916864_984916882 30 Left 984916864 4:184733256-184733278 CCTGCTCCAGCTTTTCCACCCTA 0: 1
1: 0
2: 0
3: 25
4: 244
Right 984916882 4:184733309-184733331 GGCAGCCTTCCCAGGCCCGGGGG 0: 1
1: 0
2: 3
3: 36
4: 327
984916864_984916872 9 Left 984916864 4:184733256-184733278 CCTGCTCCAGCTTTTCCACCCTA 0: 1
1: 0
2: 0
3: 25
4: 244
Right 984916872 4:184733288-184733310 CTACCAGCACCTCCTCCTCCAGG 0: 1
1: 0
2: 4
3: 90
4: 1407
984916864_984916876 22 Left 984916864 4:184733256-184733278 CCTGCTCCAGCTTTTCCACCCTA 0: 1
1: 0
2: 0
3: 25
4: 244
Right 984916876 4:184733301-184733323 CTCCTCCAGGCAGCCTTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984916864 Original CRISPR TAGGGTGGAAAAGCTGGAGC AGG (reversed) Intronic
900868654 1:5286404-5286426 TAGGATGGAAGAAGTGGAGCTGG - Intergenic
902206720 1:14873718-14873740 TAGGGAGGAAAGGCAGGTGCCGG + Intronic
902987680 1:20165080-20165102 GAGGGTGGAGAAGCTGGTGAGGG - Intronic
903687485 1:25142533-25142555 GAGGCTGGAAAGGCTGGAGGAGG + Intergenic
904566525 1:31431751-31431773 TAGGGTGGAGAGGGTGGAGAGGG + Intronic
905306849 1:37025565-37025587 TTGGGCGGAAAAGCAGGAGCGGG - Intronic
905995870 1:42380510-42380532 TGGGGTGGGACAGCCGGAGCAGG - Intergenic
907553001 1:55319890-55319912 TAGGGTGGAAAGGAGGGAGCAGG + Intergenic
907956901 1:59237606-59237628 TAGGGAGAAAAAGATAGAGCAGG - Intergenic
911091979 1:94024498-94024520 TAGGGTGGGAAAGAGGCAGCGGG - Intronic
911581923 1:99644116-99644138 TAGGCAGAAAAGGCTGGAGCTGG - Intergenic
915839398 1:159202669-159202691 CAGGGAGGAAAAGCTGGGGGAGG - Intronic
916100452 1:161389663-161389685 TAGGGTGGAGACGGAGGAGCTGG + Intergenic
916181222 1:162085416-162085438 TAGGGTGAAAACATTGGAGCAGG + Intronic
916229817 1:162530567-162530589 TAGGATTGAAAAGCAGAAGCAGG + Intergenic
917100168 1:171437390-171437412 GTGGGAGGCAAAGCTGGAGCAGG + Intergenic
918364607 1:183794276-183794298 GAGGCTGGAAAAGGTGGAGAGGG + Intronic
918577461 1:186079936-186079958 TAGGGTGTGGCAGCTGGAGCAGG + Intronic
919163367 1:193860824-193860846 TCGGGTGGAAAAGTTTGAGAAGG + Intergenic
919360182 1:196582778-196582800 TAGTTTGGACAAGCTGAAGCAGG - Intronic
920443650 1:205999187-205999209 TAGGAAGGGAAAGCTGGGGCAGG + Intronic
920686433 1:208112582-208112604 TAGCATGGAAAAGCTGCAGAGGG + Intronic
922222516 1:223619243-223619265 CAGGGAGGATAAGCTGGAGGAGG + Intronic
923627446 1:235625553-235625575 GAGGGTTGAATAGGTGGAGCAGG - Intronic
1063429824 10:5978176-5978198 TAGGGGAGCAAAGCTGCAGCAGG - Intronic
1064668699 10:17685700-17685722 TATGGTGGAAAACATGCAGCTGG + Intronic
1064867612 10:19899118-19899140 CAGGGTGGAAGAGGAGGAGCAGG - Intronic
1066717973 10:38307221-38307243 TAGGGTGAAAGAGGAGGAGCAGG + Intergenic
1069374572 10:67781046-67781068 TAGGGTGGAAGCCCTGGTGCTGG + Intergenic
1070777402 10:79117904-79117926 TGGGGTGGAAAAAGTGTAGCAGG - Intronic
1072930404 10:99657821-99657843 TAGCATGGGAAAGCTGGAGGTGG - Intergenic
1073199524 10:101723842-101723864 TAGTGAGGGAAAGCTGGGGCAGG - Intergenic
1077249818 11:1556007-1556029 TAGGATGGAGGAGCAGGAGCTGG - Exonic
1078528948 11:12121600-12121622 GAGGCTGGCAAACCTGGAGCTGG + Intronic
1080956526 11:37103169-37103191 TAAGATGGAAAAGCTAGAGGGGG + Intergenic
1082571056 11:54740985-54741007 TAGGGAAGAGAACCTGGAGCTGG + Intergenic
1082722765 11:56698610-56698632 TAGAGTGAAAACACTGGAGCTGG + Intergenic
1085637243 11:78168305-78168327 TAGGGTGGCACAGCAGGGGCTGG + Intergenic
1086217763 11:84404311-84404333 TAGGTAGGAAAAGGTGGAGATGG - Intronic
1088004784 11:104927115-104927137 TAGGGTCCCAAACCTGGAGCGGG + Intergenic
1088723205 11:112612477-112612499 GAGCCTGGAAAAGCTGGAACTGG + Intergenic
1088968462 11:114749849-114749871 CAGGGTGGCAAAGCTTGAGCAGG - Intergenic
1089608915 11:119658572-119658594 TTGGGTGGGAAAGTTGGAGGAGG - Intronic
1089744616 11:120607987-120608009 GAGGGTGGAAAAGCTTTCGCTGG + Intronic
1091270205 11:134305253-134305275 TAGGGTGCACAAGCTGGTGAAGG - Intronic
1091292069 11:134446363-134446385 TAGTGAGGAAGAACTGGAGCTGG + Intergenic
1091684201 12:2550079-2550101 ATGGGTGGAAAAGCTGCATCTGG + Intronic
1091831667 12:3554620-3554642 AAAGGTGGGAAGGCTGGAGCTGG + Intronic
1092137792 12:6161702-6161724 CAGGGTGGAACAGCTGGGGCTGG - Intergenic
1092942966 12:13427699-13427721 ACGGGTGGAAAAGGTCGAGCTGG + Intergenic
1093161688 12:15754312-15754334 GAGGAAGGAAAAGATGGAGCTGG + Intronic
1093648403 12:21615799-21615821 TAGGGTGGAAAGGGTGGTGGTGG - Intergenic
1094288719 12:28821738-28821760 CAGGGAGGAAAGGCTGGAGCAGG - Intergenic
1096591458 12:52662638-52662660 TAGGGTGGAGAACCTGTAGGAGG - Intergenic
1098705487 12:73684378-73684400 AAGGGTGGAAAAGGTGATGCTGG - Intergenic
1098890963 12:76010535-76010557 CAGGGTGGAAAAGAAGGAGGTGG - Intergenic
1100899992 12:99227285-99227307 GAGGGTGTCAAAGCGGGAGCAGG - Intronic
1101032947 12:100677890-100677912 CAGGGTGGAAATGGTGGAGGTGG - Intergenic
1102427423 12:112855160-112855182 AAGGGTGGAAGAGCTGGATTTGG - Intronic
1102719286 12:115002465-115002487 CAGGGTGGCAAAGGTGGAGGTGG - Intergenic
1102748542 12:115271759-115271781 CAGAGTGGAAAAGGAGGAGCAGG - Intergenic
1104830490 12:131747569-131747591 AAGGGTGGAAAACCCGGGGCAGG + Intronic
1105659785 13:22481477-22481499 TAATGTGGAAAAGCTGAAGTAGG - Intergenic
1106292964 13:28382482-28382504 TAGGGTTGAAGAGTTGGAGCCGG + Intronic
1106942960 13:34797063-34797085 TACAGTGGCAAAGCTGGAGCTGG + Intergenic
1107430511 13:40336200-40336222 TAGGATGGCTCAGCTGGAGCAGG - Intergenic
1107864092 13:44686701-44686723 TAGGGTGGTAGAGGTGGAGGCGG - Intergenic
1108934460 13:55868019-55868041 TAGGGAGGACAAGGTGGACCAGG + Intergenic
1111277883 13:85975162-85975184 TAGTGTTGAAAAGCTAGTGCTGG - Intergenic
1112138608 13:96612492-96612514 TAGGGTGAAAAGCTTGGAGCTGG - Intronic
1112184105 13:97111847-97111869 CAGGTTGGAAAAGCTTGACCTGG + Intergenic
1112999586 13:105618576-105618598 TAGAGTGGAGAAGGTGGAGAGGG + Intergenic
1113892447 13:113743525-113743547 GAGGGTGGCAGAGCTGGAGCAGG + Intergenic
1114223596 14:20718535-20718557 GAAGGAGGAAAAGCTGGAACTGG - Intergenic
1114631121 14:24160305-24160327 TGAGGTGGAAGAGCTGGAGACGG + Exonic
1114788151 14:25624878-25624900 AAGGGAGGAAAAGATGGAGTTGG + Intergenic
1118460259 14:65980763-65980785 GAGTGTGGAGAAGCTGGAGTTGG + Intronic
1119645283 14:76343518-76343540 TGGGGTGGCTCAGCTGGAGCTGG + Intronic
1120265219 14:82240010-82240032 TAGGGTGGTACAGCTGGAAATGG + Intergenic
1121136375 14:91502561-91502583 TAGGGTGGAAAAGCTTTTGGGGG - Intronic
1123045602 14:105512149-105512171 GAGGGAGGGAAAGCTGCAGCTGG - Intergenic
1123088557 14:105731162-105731184 AAAGGGGGAAAAGCTGGAGGAGG - Intergenic
1123146406 14:106134945-106134967 TAAGGTGCAAAAGCAGGACCAGG + Intergenic
1127495599 15:59508946-59508968 TAGTGTCCAAAAGCTGAAGCTGG - Exonic
1128901815 15:71429602-71429624 GAGGGTTGAGAAGCAGGAGCAGG + Intronic
1129012661 15:72436772-72436794 TAGGAAGGCAAAGCGGGAGCTGG - Intergenic
1130028383 15:80289772-80289794 TAGGGAGGAGAAGCAGGAGGGGG + Intergenic
1130059957 15:80562363-80562385 TTTGGTGGAAAAGCTGGGACAGG - Intronic
1130535903 15:84784752-84784774 TAGAGTGGCAAGGCTGGAGGAGG - Exonic
1131087379 15:89588399-89588421 GAGGGTGGTAAAGCTAGAGAGGG + Intronic
1132404586 15:101534785-101534807 GAGGCTGGAGATGCTGGAGCGGG + Intergenic
1132473391 16:119553-119575 AAGGGAGGATCAGCTGGAGCCGG + Intronic
1134103518 16:11469529-11469551 TGGGATGGAGAAGCTTGAGCCGG + Exonic
1134880866 16:17744823-17744845 CAGGGAGGAAAAGCTGGAGAAGG + Intergenic
1135500467 16:22991549-22991571 TAGGTTGCACAAGCTGGACCTGG - Intergenic
1136369865 16:29829697-29829719 TAGGGTGGAAAGGAAGGAGAAGG - Intronic
1136375690 16:29863876-29863898 AAGGCTGGAAAAGGGGGAGCCGG - Intergenic
1136922632 16:34345033-34345055 TAGGGAAGAAAAGATGGGGCTGG - Intergenic
1136981941 16:35066773-35066795 TAGGGAAGAAAAGATGGGGCTGG + Intergenic
1137633218 16:49962739-49962761 AAGGGTAGAAAAGCTGGGGGTGG + Intergenic
1138213227 16:55180466-55180488 TAGGGGAGAAAACCTGGGGCAGG - Intergenic
1139751920 16:69114140-69114162 TAGGGAGGTAGAGCTGGTGCTGG + Intronic
1143545265 17:7591629-7591651 TAGGGTGGACAAGAGGGAGGGGG + Exonic
1143729569 17:8873326-8873348 AGGGGTGGAAAAGTTGGAGGGGG - Intergenic
1143934982 17:10474267-10474289 TAGGGATGAAAATCTGGAGTAGG + Intergenic
1144735147 17:17551447-17551469 CAGGGTGGAGAAGCTGGCGCGGG + Intronic
1144790208 17:17853811-17853833 TTGGGTGGAGAGGCAGGAGCAGG + Intronic
1145246409 17:21272757-21272779 TTGGGTGGGGAAGCTGGTGCAGG - Intergenic
1146156808 17:30531114-30531136 TGGGGTGGGAGAGCTGAAGCTGG - Intergenic
1147149837 17:38508427-38508449 TAGGCTGGGAAAGTTGGGGCTGG + Intronic
1149626302 17:58083212-58083234 TGGGGAGGAGGAGCTGGAGCGGG - Intergenic
1149869766 17:60170908-60170930 TAGGGTGGTAAAGAAGCAGCTGG + Intergenic
1150485178 17:65538253-65538275 GAGGCTGGAAAAGCTGAAGCTGG - Exonic
1151735408 17:75936986-75937008 CAGGGTGGGAAAGCTGGTGTGGG - Intronic
1152116558 17:78391295-78391317 TCGGAAAGAAAAGCTGGAGCAGG - Intronic
1152881974 17:82822899-82822921 ATGGGTGGAAAAGCTTGAACCGG + Intronic
1152896490 17:82914320-82914342 CAGGGTGGGAAAGCTGGAGTTGG - Intronic
1152923795 17:83078823-83078845 TAGGTTGTCAAAGCTGGGGCGGG + Intergenic
1153629668 18:7057404-7057426 AAGGGTGGAAAAACTGGATTAGG - Intronic
1154435223 18:14337194-14337216 GAGGGTGGAAAGGCTGTAACTGG - Intergenic
1158512778 18:58106302-58106324 TAGGGTTAAAAAGCCTGAGCTGG - Intronic
1158906039 18:62012757-62012779 TAGGATGGAGAAGGTTGAGCTGG + Intergenic
1161424773 19:4197182-4197204 TAGGTAGGAAAGGCTGGGGCAGG + Intronic
1161484754 19:4529294-4529316 TAGGGTGGCAGAAATGGAGCTGG - Exonic
1165243084 19:34482393-34482415 GAGGCTGGAAACGCTGGAGCGGG - Exonic
1165427770 19:35755303-35755325 TGGGGTCGGAAAGCTGGAGGGGG + Exonic
1166101017 19:40571380-40571402 GAGGGTGGACAAGCAGGAGCTGG - Intronic
1166106527 19:40600598-40600620 TAGGGGTCAAGAGCTGGAGCGGG - Intronic
1166230796 19:41425047-41425069 TAAGGTGGAGAAGCTGGGGGTGG - Intronic
1166956848 19:46470636-46470658 TGGGGTGGTTGAGCTGGAGCAGG + Exonic
1166981510 19:46634622-46634644 GACGGTGGAACAGCTGAAGCTGG - Exonic
1168604428 19:57747165-57747187 CAGGGTGTAAAACCTTGAGCAGG - Intronic
924994409 2:343959-343981 GAGGGTGGGAAAGGAGGAGCAGG - Intergenic
925298487 2:2793493-2793515 GAGGGAGGAGATGCTGGAGCTGG - Intergenic
926743388 2:16130529-16130551 TAGTGTTGAAAAGATGGAGAAGG + Intergenic
926975793 2:18515579-18515601 TAGGCAGGAAAAGATGAAGCTGG + Intergenic
931311442 2:61084834-61084856 TAGGGTAGAAACGGTAGAGCTGG + Intronic
931797470 2:65724836-65724858 TAGCGTGGAAAATCTGGCTCTGG + Intergenic
932067630 2:68583266-68583288 TAGGGTAGTAAAGCTGTTGCAGG - Intronic
933721826 2:85401887-85401909 GCGGGTGGAGAAGCTGAAGCCGG - Exonic
934490798 2:94761039-94761061 GAGGGTGGAAAGGCTGTACCTGG + Intergenic
935803917 2:106728104-106728126 TAGGGTGGAAAGGCTGGCCTTGG + Intergenic
937285183 2:120746159-120746181 TGGTCAGGAAAAGCTGGAGCAGG + Intronic
937991143 2:127663248-127663270 GAGTGTGGCAGAGCTGGAGCAGG - Intronic
939127272 2:138192773-138192795 TTAGGTGGCAAAGCTGGATCTGG - Intergenic
942452971 2:176120073-176120095 TGGGGGAGAAAAGCTGGAGGAGG + Intergenic
942457587 2:176148657-176148679 TTGGTTGGAAAAGCTGGGGCTGG + Intergenic
942543403 2:177038026-177038048 CAGTGTGGACCAGCTGGAGCAGG - Intergenic
942911529 2:181250452-181250474 TTGGGGGGCAGAGCTGGAGCTGG - Intergenic
944661356 2:201924357-201924379 CAGGGTGGAGAAGATGGAGTGGG - Intergenic
946103005 2:217343243-217343265 TATGGTGGTAAAGCTGGAACTGG - Intronic
946558951 2:220891081-220891103 TAGGGAGGAAATGCTGAGGCAGG + Intergenic
948308962 2:236970924-236970946 TAGGATGCAAAGGCTGGGGCTGG + Intergenic
1170687429 20:18582039-18582061 TACGGAGGAAAATCTGGACCTGG - Intronic
1171126585 20:22607426-22607448 TAGGGTGGAGAAGCGGGCTCTGG - Intergenic
1172303931 20:33868400-33868422 AAGCCTGGAGAAGCTGGAGCGGG - Intergenic
1172832015 20:37844013-37844035 TAGGGTAGAAAAGATGGAAACGG - Intronic
1173193987 20:40898947-40898969 TGGGGAGGAAAAGCTGGGGTAGG + Intergenic
1173225983 20:41162755-41162777 TGGGGTGGAAGAGCAGGGGCAGG - Intronic
1173728429 20:45312500-45312522 CAGAGTGGAAAAGGTGGAGTCGG + Intronic
1174397887 20:50259152-50259174 TAGGGTCCAAAAGCTAGAGTAGG - Intergenic
1175176437 20:57115169-57115191 TAAGGTGAAGAATCTGGAGCTGG + Intergenic
1176457533 21:6927598-6927620 CTTGGTGCAAAAGCTGGAGCTGG + Intergenic
1176835707 21:13792682-13792704 CTTGGTGCAAAAGCTGGAGCTGG + Intergenic
1176841813 21:13848507-13848529 GAGGGTGGAAAGGCTGTACCTGG + Intergenic
1178580165 21:33831588-33831610 GAGGTTGGAACAGCAGGAGCAGG + Intronic
1180052978 21:45341384-45341406 CCGGGTGGGAAAGCTGGACCAGG - Intergenic
1180063708 21:45402564-45402586 TGGGGTGGAGCAGGTGGAGCAGG - Intergenic
1180237514 21:46472581-46472603 GAGGGTGGAGAAGGAGGAGCGGG + Intronic
1181465298 22:23107599-23107621 TAGGGAGCAGAAGCTGGGGCGGG + Intronic
1184033715 22:41909052-41909074 AATGGGGGAAAAGCTGGAGCAGG - Intergenic
949803964 3:7934328-7934350 TATGGAGGACAAGCTGAAGCAGG + Intergenic
950517174 3:13474902-13474924 AAGGGTGAGAAAGCTGGAGTGGG + Intergenic
950839125 3:15949976-15949998 TGGGGTGGAGAAGATGGAGGAGG - Intergenic
952569375 3:34695880-34695902 CAGGTTGGAAATGCTAGAGCTGG + Intergenic
955083420 3:55678798-55678820 TTGGGTGTCAAAGCTGGAGCAGG - Intronic
956521111 3:70105354-70105376 GAGTGGGGAGAAGCTGGAGCTGG + Intergenic
957248283 3:77739830-77739852 TTGGACGGCAAAGCTGGAGCAGG + Intergenic
958266151 3:91439745-91439767 TAGGATTTAAAAGCTGGAACAGG + Intergenic
960635435 3:119780491-119780513 GAGGGTGGGAAAGCTGGAAAGGG - Intronic
961703886 3:128768789-128768811 TAAGGTGGAAAGGCTGAAGCTGG - Intronic
962236149 3:133709362-133709384 TATGGTGGCTATGCTGGAGCTGG - Intergenic
962395727 3:135014021-135014043 TGGGGTGGGAAAGGTGGAGCTGG + Intronic
963587321 3:147208657-147208679 TAGGGTGGAACTGATGGAGATGG - Intergenic
964261911 3:154849019-154849041 CAGTGTGGAAAAGGTGGAGAAGG + Intergenic
964514513 3:157493353-157493375 TAGAGAGGAATAGCTGGGGCTGG + Intronic
968870554 4:3239864-3239886 CAGGATGGGCAAGCTGGAGCAGG + Exonic
969134820 4:5021109-5021131 CAGTGGGGACAAGCTGGAGCCGG - Intergenic
970218809 4:13786246-13786268 TAGTGTGCAAAGGCTGGTGCAGG - Intergenic
972746321 4:41935648-41935670 TGGGGTGGGGAAGTTGGAGCGGG + Intronic
975941264 4:79649627-79649649 TAAGATGGAAGAGTTGGAGCAGG - Intergenic
980382492 4:132041601-132041623 TAGGGTGGACAGGCTGCATCTGG - Intergenic
981034188 4:140153012-140153034 TCAGGTGGAGCAGCTGGAGCTGG - Exonic
982237118 4:153261956-153261978 GAGGGAAGAAACGCTGGAGCTGG + Intronic
983693162 4:170497293-170497315 GAGGGTAGGGAAGCTGGAGCGGG - Intergenic
983698260 4:170559507-170559529 TTGGGAGGAGAAGCAGGAGCAGG - Intergenic
984916864 4:184733256-184733278 TAGGGTGGAAAAGCTGGAGCAGG - Intronic
993953874 5:94208668-94208690 GAGGATGGGAAAGATGGAGCTGG + Intronic
996453885 5:123657919-123657941 TAGGGTGAAGAAGCTGAAGAGGG + Intergenic
997356558 5:133266472-133266494 AAGGGTGGAGAGGCAGGAGCCGG - Intronic
997474342 5:134133977-134133999 TCAGGTGGCAAAGCTGGACCTGG + Intronic
999732433 5:154484574-154484596 TACTGGGGAAAAGCTAGAGCCGG + Intergenic
1000742030 5:164980256-164980278 TATGGGGGAAAAGCTGAAGTAGG - Intergenic
1001714773 5:173806412-173806434 GAAGGCGGAGAAGCTGGAGCAGG - Intergenic
1001939459 5:175730166-175730188 CAGGGTGGAAATGGTAGAGCGGG - Intergenic
1002597226 5:180332134-180332156 GAGGTGGGAAAAGCTGCAGCTGG - Intronic
1003507220 6:6750039-6750061 TAGAGCTGAAAAGCTGCAGCTGG - Intergenic
1005745991 6:28838267-28838289 AAAGGTGGAAAAGATGGAGCTGG - Intergenic
1006770193 6:36546951-36546973 TGGGGTGGAAAGGCTGGGACTGG + Intronic
1008048722 6:46878035-46878057 TAGAGTGGCTAAGCTGGAGCTGG + Intronic
1008989123 6:57582228-57582250 TAGGATTTAAAAGCTGGAACAGG - Intronic
1009177657 6:60480469-60480491 TAGGATTTAAAAGCTGGAACAGG - Intergenic
1009642813 6:66360600-66360622 TAAGGTGGAAACACTGGAACTGG + Intergenic
1011087694 6:83560874-83560896 TCGGTTGGACAACCTGGAGCAGG - Exonic
1012003069 6:93678889-93678911 TAGGGAAGAACAGCTAGAGCTGG - Intergenic
1015378806 6:132543405-132543427 TATGTTGTAAATGCTGGAGCTGG + Intergenic
1016277008 6:142365684-142365706 TAGGGAGGAAGAGCAGGAGGAGG + Intronic
1016309197 6:142715047-142715069 GAGCTTGGAAAAGCTAGAGCTGG - Intergenic
1017499954 6:155015045-155015067 TAGGGTGTGCATGCTGGAGCTGG + Intronic
1019225761 6:170506677-170506699 GAGGGCGGAAAGGCTGGAACAGG + Intergenic
1020193866 7:6021958-6021980 TTGGGTGGAAGAGGTGGAGGAGG - Intronic
1020306946 7:6842713-6842735 CCGGGTGGAACAGCTGGACCTGG + Intergenic
1020785765 7:12570852-12570874 GAGGATTGAGAAGCTGGAGCTGG + Exonic
1022625962 7:32036246-32036268 TAGGATGGATATGCTGGGGCAGG - Intronic
1022923567 7:35038311-35038333 TAGGATGGATTGGCTGGAGCAGG + Intergenic
1024890002 7:54189176-54189198 TTGGTTGGAAAAAGTGGAGCTGG + Intergenic
1026484474 7:70806556-70806578 CACGTTGGAAAAGCTGCAGCGGG - Intergenic
1026528820 7:71179561-71179583 TATGGTGAAAAAGCAGCAGCTGG - Intronic
1027999145 7:85468653-85468675 TAGGAGGGAAAGGGTGGAGCTGG + Intergenic
1029480418 7:100809063-100809085 TAGGGAGCAAGAGCAGGAGCTGG - Intronic
1035035398 7:155891206-155891228 TGGGGTGGAATTGCTGGAGGTGG + Intergenic
1036163343 8:6408642-6408664 TAGGGTGGAGAAGCTGAGGTGGG - Intronic
1037125184 8:15339954-15339976 TAGAATTGAAAATCTGGAGCAGG + Intergenic
1037645641 8:20790422-20790444 TAGGGTAGACAAGGTGGAGAAGG - Intergenic
1037655095 8:20876193-20876215 TAGACTGGGAAAGCAGGAGCAGG + Intergenic
1038505219 8:28078490-28078512 ATGGGTGGTAAAGCTGGAGCTGG - Intronic
1042351776 8:67784235-67784257 TAAGGTGAAAAACCTGGAGATGG - Intergenic
1042463053 8:69093289-69093311 TGGGGTGGGAAAGATGGAGGAGG + Intergenic
1044493895 8:92853175-92853197 GAGGATGAAAAAGCAGGAGCTGG - Intergenic
1044790514 8:95842193-95842215 TTGGGTGTAAAAGCGGGAGGTGG - Intergenic
1046887473 8:119383410-119383432 TAGGGTAGAAAATCTTGGGCAGG - Intergenic
1047005781 8:120618825-120618847 GAGGGTGGAAAATCTAGAGCTGG + Intronic
1047718912 8:127620526-127620548 TAGGGTGGCTGAGGTGGAGCGGG + Intergenic
1050083732 9:1942143-1942165 TAGGGTGGAAAAGGAGGAATTGG + Intergenic
1051259315 9:15246801-15246823 TGGGGTGGCTCAGCTGGAGCTGG - Intronic
1052881319 9:33602472-33602494 GAGGGTGGAAAGGCTGTATCTGG - Intergenic
1053319281 9:37080579-37080601 TTCGGTGGAAAAGCTGTGGCTGG + Intergenic
1053323598 9:37121206-37121228 TTCGGTGGAAAAGCTGTGGCTGG + Intronic
1053494999 9:38543370-38543392 GAGGGTGGAAAGGCTGTATCTGG + Intronic
1055032354 9:71783382-71783404 GAGGGTGGAAAGGGTGGAGGTGG + Intronic
1057401912 9:94731042-94731064 CAGGTTGGAAAAGCAGCAGCAGG + Intronic
1057786463 9:98091864-98091886 TAGGGTGGAGACGGTGGAGATGG - Intronic
1058613809 9:106804162-106804184 TAGGGTGGAAAAGAGGGATAGGG + Intergenic
1059336807 9:113574323-113574345 TAGGGGGGAAAAGATGGGACAGG - Intronic
1059419770 9:114183571-114183593 TAGGGTGGAAAGGATGGTGGTGG + Intronic
1060279009 9:122203574-122203596 TGGGGTGGAAGAGTTGTAGCAGG + Exonic
1061942468 9:133891214-133891236 GAGGGAGAAGAAGCTGGAGCTGG - Intronic
1062202328 9:135310057-135310079 CAGGGAGGAAGAGCTGCAGCGGG + Intergenic
1062215910 9:135389786-135389808 GAGGGGGGAAGAGCTGGAGGGGG + Intergenic
1186233089 X:7477391-7477413 AAGGGTGGAATAGGTGGAGTGGG + Intergenic
1186482123 X:9904029-9904051 TAAGGAGGAGAAGCGGGAGCAGG + Intronic
1192358383 X:70423723-70423745 TAGGGGTGAGGAGCTGGAGCTGG - Intronic
1193540181 X:82761709-82761731 AAGGGAGGAAAAGATGGAGGGGG + Intergenic
1194236056 X:91384191-91384213 TAGGAAGGTAAAGCAGGAGCAGG - Intergenic
1195521698 X:105837925-105837947 TAGGGTGGCAAAATTGGAGGTGG + Intronic
1197206343 X:123794010-123794032 TTGGATGGCAAAGCAGGAGCAGG - Intergenic
1198551655 X:137751726-137751748 TATGGTGGAAAGGCTGGATGAGG - Intergenic
1198680968 X:139181818-139181840 AAGGGTGGAGAAGGTGGAGAGGG + Intronic
1198981378 X:142400168-142400190 TGGGGTGGGGAAGCTGGAGCAGG - Intergenic
1199769947 X:150968941-150968963 TGGCGAGGAAAAGCAGGAGCTGG - Intergenic