ID: 984920845

View in Genome Browser
Species Human (GRCh38)
Location 4:184762890-184762912
Sequence GGCCCGGTGGCCTCAGTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 1, 2: 0, 3: 20, 4: 177}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984920845_984920852 19 Left 984920845 4:184762890-184762912 CCAGGAACTGAGGCCACCGGGCC 0: 1
1: 1
2: 0
3: 20
4: 177
Right 984920852 4:184762932-184762954 GCCCAAATCCCTATGAGGCCTGG 0: 1
1: 0
2: 3
3: 11
4: 113
984920845_984920850 14 Left 984920845 4:184762890-184762912 CCAGGAACTGAGGCCACCGGGCC 0: 1
1: 1
2: 0
3: 20
4: 177
Right 984920850 4:184762927-184762949 CTCCAGCCCAAATCCCTATGAGG 0: 1
1: 0
2: 1
3: 6
4: 155
984920845_984920855 25 Left 984920845 4:184762890-184762912 CCAGGAACTGAGGCCACCGGGCC 0: 1
1: 1
2: 0
3: 20
4: 177
Right 984920855 4:184762938-184762960 ATCCCTATGAGGCCTGGCAGAGG 0: 1
1: 0
2: 1
3: 15
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984920845 Original CRISPR GGCCCGGTGGCCTCAGTTCC TGG (reversed) Intronic
900329492 1:2126923-2126945 GGCCCGGTGCCCACAGGGCCGGG + Intronic
900350064 1:2230109-2230131 GGCCCGGATGCCTCAGGCCCAGG + Intronic
900500301 1:3001290-3001312 GGTCCTGCAGCCTCAGTTCCTGG + Intergenic
900710277 1:4109062-4109084 GGCCGGGTGGCCTCAGATGATGG - Intergenic
901666555 1:10829505-10829527 TGCCAGGTTGTCTCAGTTCCTGG - Intergenic
901701035 1:11044871-11044893 AGCCTGCTGGCCTCAGCTCCGGG - Intronic
904576162 1:31506371-31506393 GGCCCGGAGCCCTCCATTCCGGG - Intergenic
905423317 1:37863104-37863126 GGCCCGGTGGCCCCTGTCCAAGG + Intronic
905892184 1:41524483-41524505 GGCCGGGTGGCCACAGGTGCAGG + Intronic
908901885 1:68965007-68965029 TTCCAGGTGGCCTCAGCTCCTGG - Intergenic
914050520 1:144126630-144126652 GGGGAGGTGGCCTGAGTTCCTGG + Intergenic
914128662 1:144838815-144838837 GGGGAGGTGGCCTGAGTTCCTGG - Intergenic
916750955 1:167722271-167722293 GGCCCGGGGGCCCCACTCCCCGG - Intronic
916868581 1:168887595-168887617 GCAGCGGTGGGCTCAGTTCCAGG - Intergenic
919888106 1:201949774-201949796 GGCCCAGTGGTCTCTGCTCCAGG + Intergenic
922023120 1:221724095-221724117 TGGCCGTTGTCCTCAGTTCCTGG - Intronic
923722895 1:236482466-236482488 GGCTCTGTGGCCTCTGCTCCAGG - Exonic
924948079 1:248859077-248859099 GGGGCGCGGGCCTCAGTTCCGGG - Intronic
1065033451 10:21612057-21612079 GGCCCGCCAGCCTCAGTGCCTGG + Intronic
1067684292 10:48457690-48457712 GGCCTGGAAGCCTCAGTGCCTGG - Intronic
1069036495 10:63651055-63651077 GGCTCAGTGGCCACACTTCCAGG + Intergenic
1069894728 10:71673301-71673323 GGTGTGGAGGCCTCAGTTCCAGG - Intronic
1069902329 10:71713347-71713369 TGCCCAGAGGCCTCAGTTGCTGG + Exonic
1070071744 10:73096724-73096746 TGCCCAGTGGCCTCAGTCTCCGG + Intronic
1073146003 10:101282413-101282435 TGCCCAGAGACCTCAGTTCCTGG + Intergenic
1073287058 10:102395624-102395646 GGGCCAGTGGCGTCATTTCCAGG + Intronic
1073498158 10:103912682-103912704 GGCCAGGTGGCCTGAGCTCCAGG + Intronic
1073535102 10:104269214-104269236 GGTCCGGTTGCCCGAGTTCCCGG + Exonic
1074769461 10:116723902-116723924 GACCCGCTGGCCTCAGCTACTGG - Intronic
1075076952 10:119358132-119358154 GGCCAGCTTGCCTGAGTTCCTGG + Intronic
1075598657 10:123750839-123750861 GGCACGCTGTCCTCAGTTCTTGG + Intronic
1075733649 10:124651254-124651276 GGCCCTGGGGCCTCAGCTCCTGG - Intronic
1076882192 10:133245041-133245063 GGCCAGGAGGCCTCCGTTTCTGG + Intergenic
1076884342 10:133254760-133254782 AGCCCGGTGGCCCCAGCTCCTGG - Intergenic
1077219193 11:1407951-1407973 GGGCAGGTGGGCTCAGCTCCAGG - Intronic
1077652206 11:3983339-3983361 AGCGAGGTTGCCTCAGTTCCTGG + Intronic
1078227888 11:9409483-9409505 GGCACAGTGGCCTCAGCCCCCGG + Intronic
1078465386 11:11546291-11546313 GTCCCGATGGCCTCAGGTCCTGG - Intronic
1079380456 11:19933379-19933401 GGCCTGGGGGCCTCAGGCCCAGG - Exonic
1081576683 11:44323065-44323087 GGGCTAGTGGCCTCAGCTCCAGG + Intergenic
1083258884 11:61512645-61512667 GGCCCGGGGGACTCATTGCCAGG - Intergenic
1083440233 11:62671483-62671505 GACCCTGTGTCCTCAATTCCGGG - Exonic
1083941574 11:65899287-65899309 GTCCCAGTGACCCCAGTTCCGGG + Intronic
1084147804 11:67274376-67274398 AGCCCGGTGGCCCCCATTCCTGG + Intronic
1084302715 11:68261916-68261938 GGCCCAGTGGAATCAGTACCTGG + Exonic
1084652429 11:70496939-70496961 GGCAAGGTGGCCACAGTTTCAGG - Intronic
1086434454 11:86767581-86767603 ATCTCTGTGGCCTCAGTTCCTGG + Intergenic
1089345562 11:117789225-117789247 GGCCCTGTGCCATCAGCTCCAGG + Intronic
1090381343 11:126329651-126329673 GGTGAGATGGCCTCAGTTCCAGG + Intronic
1100712759 12:97275602-97275624 GGCTCGGTGGCCTCTGAGCCTGG + Intergenic
1102689670 12:114750510-114750532 GGCCCACAGGCCTCAATTCCTGG + Intergenic
1104608637 12:130208858-130208880 TGGCTGGAGGCCTCAGTTCCTGG - Intergenic
1104662604 12:130621855-130621877 GGCCTGCTGGCCTCAGTACCAGG - Intronic
1104747603 12:131219891-131219913 GTCCCAGTGCCCTCAGGTCCTGG + Intergenic
1104785218 12:131444484-131444506 GCCCCAGTGCCCTCAGGTCCTGG - Intergenic
1104845755 12:131845981-131846003 GCCCCGGTGCCCACCGTTCCAGG + Intronic
1104893498 12:132151196-132151218 GCCTTGGAGGCCTCAGTTCCCGG + Intronic
1106247212 13:27960663-27960685 AGCGCGGTGGCCTCACTTGCCGG + Intergenic
1113612631 13:111658280-111658302 GGCCCTGTGGCCGCCGTGCCTGG - Intronic
1114558515 14:23576042-23576064 GGCCCGCTGGCCTCCGAGCCGGG + Exonic
1116867091 14:50039941-50039963 AGCCCTGTGACCACAGTTCCAGG - Intergenic
1118990304 14:70791598-70791620 GGCCTGCTGGCCTCACTGCCTGG + Intronic
1119406496 14:74402612-74402634 GGCCAGGTGGCCTCAGTTCCTGG + Intergenic
1121174532 14:91881180-91881202 GGCCAGGTCCCCTCACTTCCTGG + Intronic
1121674448 14:95741074-95741096 GGCCCTGAGGACTCATTTCCTGG + Intergenic
1122624009 14:103075108-103075130 GGCCGGATGACCTCAGCTCCGGG + Intergenic
1123067988 14:105627833-105627855 GCCCCGGTCGCCTGAGCTCCAGG + Intergenic
1123420395 15:20125940-20125962 GGGGAGGTGGCCTGAGTTCCTGG + Intergenic
1123445464 15:20327584-20327606 GGGGAGGTGGCCTGAGTTCCTGG - Intergenic
1123529619 15:21132476-21132498 GGGGAGGTGGCCTGAGTTCCTGG + Intergenic
1125516495 15:40323951-40323973 GGCCCGGCGCCCTCGGTTCCCGG - Intergenic
1127846636 15:62876605-62876627 GGCCCTGTGTCCTCCCTTCCTGG + Intergenic
1128733558 15:70036655-70036677 GGCCCTGCTGGCTCAGTTCCAGG - Intergenic
1131140436 15:89972716-89972738 GGCCCAGTGGGCAGAGTTCCAGG - Intergenic
1131643083 15:94313364-94313386 TGCCCTGTGGACTCATTTCCTGG + Intronic
1132426905 15:101724956-101724978 GGCCCAGAGGCCTCAGTACTTGG - Intergenic
1132566352 16:625339-625361 GGTGCAGGGGCCTCAGTTCCCGG - Intronic
1132896356 16:2231090-2231112 GGCCCGGTGGGCTTAGTCCAGGG + Intronic
1132978087 16:2720415-2720437 GTGCCGTTGGCCTCGGTTCCTGG + Intronic
1133226140 16:4341352-4341374 GGCCCAGTGGCCTCACCTTCTGG + Exonic
1137651417 16:50123919-50123941 GGCCAGAGGTCCTCAGTTCCTGG + Intergenic
1138162956 16:54773401-54773423 TGCCAGGTGGCCCCACTTCCAGG + Intergenic
1139509028 16:67416050-67416072 GAGCCGGTGGCCTGAGTTCCAGG - Intronic
1141461808 16:84182261-84182283 GGCGCGCTGGCCTGGGTTCCTGG - Exonic
1141618868 16:85225972-85225994 TGGCTGGAGGCCTCAGTTCCTGG + Intergenic
1142664855 17:1456578-1456600 GGCCCTGGGGCCTGAGTTCTCGG + Intronic
1143691073 17:8566496-8566518 TGGCTGGAGGCCTCAGTTCCTGG - Intronic
1146001890 17:29135626-29135648 GGCCCGGTGTCCTCACAGCCTGG - Intronic
1146297573 17:31661754-31661776 TGCCCAGAGGGCTCAGTTCCAGG + Intergenic
1148438433 17:47699402-47699424 GGCCCGGGGGGCTCAGCTCCGGG + Exonic
1151955191 17:77376611-77376633 GGCCCTGTGGCCTCTGTTACAGG - Intronic
1152488957 17:80615863-80615885 GGCCCGGAGGCCTTTCTTCCAGG + Intronic
1152883336 17:82832998-82833020 GGCTCGGTGTCCTCAGCCCCCGG - Intronic
1158628107 18:59089161-59089183 GGACCTCTGGCCACAGTTCCTGG + Intergenic
1160426260 18:78781270-78781292 GCCCAGGTGCCCTCAGTGCCGGG + Intergenic
1160805590 19:991028-991050 GGCCCGATGCCCTCAGCCCCAGG - Intronic
1160891167 19:1379492-1379514 GGTCCAGTGTCCTCAGTGCCAGG - Intergenic
1161118959 19:2514607-2514629 CGCCCGGTGGCAATAGTTCCGGG - Exonic
1161772920 19:6241203-6241225 GTTCCGGCGGCCTCAGTTCAGGG - Intronic
1162111650 19:8403078-8403100 GACCCCCTGGCCCCAGTTCCTGG + Intronic
1164188453 19:22893980-22894002 GGCCCGGCGGCCCCTGTTCCAGG + Intergenic
1165725802 19:38111738-38111760 GGAGAGGTGGCCTCAGGTCCAGG - Intronic
1166510971 19:43408348-43408370 GGCCCGGTGGCCCCTATTCGAGG + Intronic
1166896073 19:46022627-46022649 AGCCAGGTGGCCTCAGCACCAGG + Intronic
1167239397 19:48334213-48334235 CGCCCCGTGGGCTCAGTTCGGGG + Intronic
1168308958 19:55451387-55451409 GGCGCGGGGACCCCAGTTCCGGG + Intergenic
1168405091 19:56106568-56106590 GGCCGTCTGGCCCCAGTTCCTGG + Intronic
1202689927 1_KI270712v1_random:79268-79290 GGGGAGGTGGCCTGAGTTCCTGG + Intergenic
925878350 2:8330421-8330443 GAGCCTGTGGCCTCAGGTCCAGG - Intergenic
926051254 2:9746275-9746297 TGGCTGGTGTCCTCAGTTCCAGG + Intergenic
928823598 2:35392076-35392098 GGCCAGGTCGCCACAGTGCCTGG + Intergenic
929484094 2:42339464-42339486 GGCGCGGTGGCTTGAGCTCCAGG + Intronic
931710948 2:64989009-64989031 GGCCCCGAGGACTCAGATCCCGG + Intronic
933956491 2:87376755-87376777 GGGGAGGTGGCCTGAGTTCCTGG - Intergenic
934240637 2:90268781-90268803 GGGGAGGTGGCCTGAGTTCCTGG - Intergenic
934272555 2:91547978-91548000 GGGGAGGTGGCCTGAGTTCCTGG + Intergenic
937120571 2:119437602-119437624 GGCCCGGGGGCCTCTGCACCTGG + Exonic
942134183 2:172909068-172909090 GGCAGGGTGGCCTCAGTGTCAGG + Intronic
947544508 2:231001380-231001402 GGTTGGGGGGCCTCAGTTCCTGG - Intronic
948425500 2:237884671-237884693 GGCCCAGTGACCTCAGATGCTGG - Intronic
948515892 2:238503730-238503752 ATCCCAGTGGCCTGAGTTCCAGG - Intergenic
948653573 2:239463773-239463795 GGCCAGGAGGCCTCAGGTGCAGG + Intergenic
949017365 2:241720911-241720933 TGCACGGTGGCCTCAGCTTCTGG + Intronic
949027177 2:241771808-241771830 GGCCGGGTGGTCTCAGCCCCAGG + Intergenic
1170102974 20:12722494-12722516 GGTTTGGTGGACTCAGTTCCAGG + Intergenic
1170519021 20:17163803-17163825 GGCAAGGTGGCTTCTGTTCCTGG - Intergenic
1171813558 20:29763848-29763870 GGCCCGGGGCCCACAGTTCTGGG + Intergenic
1174172298 20:48625274-48625296 GGGCTGGTGGCCCCAGTTCCAGG + Exonic
1175314851 20:58040087-58040109 GGCCGCCTGGCCTCAGTTCCAGG - Intergenic
1176055931 20:63149088-63149110 GGACTGGTGGTCTCAGTGCCAGG - Intergenic
1179720621 21:43314207-43314229 GGCCTGGTGGCCTCAGGGCACGG + Intergenic
1179847491 21:44119540-44119562 GTCCCGTTGGCCTCTGTGCCTGG + Intronic
1180988260 22:19918157-19918179 GACACGGTGGCCCCAGTTCAAGG + Exonic
1181171957 22:21014927-21014949 TGCCCTCTGGCCTCACTTCCTGG - Intronic
1181853153 22:25764454-25764476 GGTCTGGTGGCCTCAGGGCCTGG + Intronic
1182063921 22:27417084-27417106 TGCCTTGTGGCCTCACTTCCTGG + Intergenic
1183676023 22:39299336-39299358 GGCTCGGAGGCCTCAGCTCATGG - Intergenic
1184456835 22:44615785-44615807 GGACTGGTGGATTCAGTTCCTGG - Intergenic
1184748802 22:46472612-46472634 GGACGGGTGGCATCAGCTCCCGG + Intronic
952347460 3:32502370-32502392 GGCTGGGTGGCCCCAGTTCGTGG + Intronic
953407641 3:42667356-42667378 AGCCCTGTGGCCACAGTTCTGGG + Intergenic
955368658 3:58332677-58332699 GACCCGGTGCCCTTAGCTCCGGG - Intergenic
955931139 3:64058037-64058059 TGGCAGGAGGCCTCAGTTCCTGG + Intergenic
960844388 3:121993312-121993334 TGCCCTCCGGCCTCAGTTCCTGG - Exonic
961999453 3:131279982-131280004 GGCTGGGAGGCCTTAGTTCCTGG + Intronic
962948881 3:140199691-140199713 GGCCCACTGGCCTCATTTCTGGG - Intronic
968732412 4:2275773-2275795 AGCCCGGTGGCCTCTGTTGCCGG + Intronic
968789863 4:2652085-2652107 GGGCTGGTGGCCTCTGTGCCTGG + Intronic
969307324 4:6333303-6333325 GGCCCAGGGGCCTCAATTCCAGG - Intronic
976389736 4:84496455-84496477 GGCCCGGCTGCCACAGTCCCCGG + Intronic
979923509 4:126530120-126530142 GGCCCTGTTTCCTCAGTTCAGGG - Intergenic
984920845 4:184762890-184762912 GGCCCGGTGGCCTCAGTTCCTGG - Intronic
989749496 5:44876204-44876226 GGCCTGGAGGCCACTGTTCCAGG - Intergenic
995784665 5:115815959-115815981 CGCGCGGTGGCCTCCCTTCCCGG + Intronic
997191941 5:131945655-131945677 GGCCCGGCGGCTCCAGTTCTGGG - Intronic
997402165 5:133611859-133611881 GGCCCGGTGCCCTTGGCTCCGGG - Intronic
1001131014 5:169063472-169063494 GGCTTGGGAGCCTCAGTTCCAGG - Intronic
1001225752 5:169943369-169943391 GGCCCGCGGGCCACAGGTCCAGG - Intronic
1001531340 5:172464236-172464258 GACCCTATGGCCTAAGTTCCAGG + Intergenic
1002162116 5:177320513-177320535 TGCCCTGTGGCCTGAGTCCCAGG - Intergenic
1004283516 6:14300385-14300407 GGCCCGGTGGCCAGATTTCCGGG + Intergenic
1006164897 6:32058327-32058349 GGCCCTGGGGCCTCTGTGCCTGG + Intronic
1007383408 6:41504522-41504544 GCGCGGGTGGGCTCAGTTCCCGG + Intergenic
1019599045 7:1872338-1872360 GGACCAGGGGCCTCACTTCCTGG - Intronic
1019606843 7:1914171-1914193 GGCCTGGAGGCCTCAGGACCTGG + Intronic
1021959657 7:25858999-25859021 GGCCCGGCAGCCTCAGATCTTGG + Intergenic
1022709077 7:32834656-32834678 GGCCCAGTGGCCAGATTTCCAGG - Intergenic
1025093399 7:56080908-56080930 GGGATCGTGGCCTCAGTTCCAGG + Exonic
1025263440 7:57438011-57438033 TGCCCCGAGGCCCCAGTTCCTGG + Intergenic
1026902754 7:74046136-74046158 GGCCCAGTGTCCACAGTTCCAGG + Intronic
1027539818 7:79453328-79453350 GGGCGAGTCGCCTCAGTTCCTGG + Exonic
1029439000 7:100577208-100577230 GGCTCGGTGGCCCCATTTCCAGG + Intronic
1029458654 7:100683438-100683460 GGGCCACTGGTCTCAGTTCCAGG - Exonic
1030079225 7:105762929-105762951 TGGCTGGAGGCCTCAGTTCCTGG - Intronic
1035045527 7:155963091-155963113 GGCCCGATGGCCTCAGAGCCGGG - Exonic
1035308278 7:157947454-157947476 GGATTGGTGGCCTAAGTTCCTGG + Intronic
1036052980 8:5220951-5220973 GGCCAGGTAGCCCCAGGTCCTGG - Intergenic
1040080263 8:43276983-43277005 GCCTCCGTGGCCTCAGCTCCTGG + Intergenic
1049312046 8:141938474-141938496 GAGCCGGTGGCCTCAGCTCACGG + Intergenic
1049422660 8:142523820-142523842 GGCCCCGTGGCCTCAGCACCTGG - Intronic
1056665417 9:88577379-88577401 GACACGGTGGCCTCTGTTCCAGG + Intronic
1056678369 9:88696146-88696168 GGACTGATGGCCTCAGTCCCTGG + Intergenic
1056788024 9:89606244-89606266 GGCCCGGTGGCGGCAGGGCCAGG + Exonic
1057097622 9:92326132-92326154 GGCCCGCTGGCCAGGGTTCCCGG + Intronic
1057155749 9:92837462-92837484 GGCCCCGGGGCCTGAGTTTCCGG + Intergenic
1057662160 9:97013220-97013242 GGCCCGGCGGCCTGAATGCCGGG - Intronic
1059329139 9:113524162-113524184 GTTCCAGTGGCCTCTGTTCCTGG + Intronic
1060482175 9:124022977-124022999 GTCCCAGTGGCCTGAGCTCCTGG + Intronic
1060670808 9:125467696-125467718 GGCCCTGTGCCCCCAGCTCCCGG + Intronic
1060796602 9:126516304-126516326 GGCTCGGTGGCCTCCTCTCCCGG + Intergenic
1061037353 9:128121076-128121098 GGCCCAGTGGCCCCAGGCCCTGG + Exonic
1061374134 9:130214214-130214236 GGCCCGGAGGCCTCAGACCTGGG + Intronic
1061952788 9:133945620-133945642 GCCCGGGTGTCCTCAGTCCCAGG + Intronic
1185479554 X:435780-435802 GGAGCGGTGGCCCCAGGTCCCGG + Intergenic
1187701545 X:21968356-21968378 GGCCCTGTGACCTCAATTTCTGG - Intronic
1188517822 X:31006122-31006144 GGCCCAGTGCCCTCAGTTGGAGG + Intergenic
1189274787 X:39777905-39777927 TGCCAGGTGGCCTCAGCTTCTGG - Intergenic
1200725558 Y:6665002-6665024 GACCCAGTGGCCTCAGTGCTTGG - Intergenic
1201076540 Y:10194040-10194062 GGCCCTGTGTCCTGAGCTCCTGG - Intergenic