ID: 984920845

View in Genome Browser
Species Human (GRCh38)
Location 4:184762890-184762912
Sequence GGCCCGGTGGCCTCAGTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 1, 2: 0, 3: 20, 4: 177}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984920845_984920855 25 Left 984920845 4:184762890-184762912 CCAGGAACTGAGGCCACCGGGCC 0: 1
1: 1
2: 0
3: 20
4: 177
Right 984920855 4:184762938-184762960 ATCCCTATGAGGCCTGGCAGAGG 0: 1
1: 0
2: 1
3: 15
4: 150
984920845_984920852 19 Left 984920845 4:184762890-184762912 CCAGGAACTGAGGCCACCGGGCC 0: 1
1: 1
2: 0
3: 20
4: 177
Right 984920852 4:184762932-184762954 GCCCAAATCCCTATGAGGCCTGG 0: 1
1: 0
2: 3
3: 11
4: 113
984920845_984920850 14 Left 984920845 4:184762890-184762912 CCAGGAACTGAGGCCACCGGGCC 0: 1
1: 1
2: 0
3: 20
4: 177
Right 984920850 4:184762927-184762949 CTCCAGCCCAAATCCCTATGAGG 0: 1
1: 0
2: 1
3: 6
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984920845 Original CRISPR GGCCCGGTGGCCTCAGTTCC TGG (reversed) Intronic