ID: 984920850

View in Genome Browser
Species Human (GRCh38)
Location 4:184762927-184762949
Sequence CTCCAGCCCAAATCCCTATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 155}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984920844_984920850 15 Left 984920844 4:184762889-184762911 CCCAGGAACTGAGGCCACCGGGC 0: 1
1: 0
2: 0
3: 20
4: 178
Right 984920850 4:184762927-184762949 CTCCAGCCCAAATCCCTATGAGG 0: 1
1: 0
2: 1
3: 6
4: 155
984920847_984920850 1 Left 984920847 4:184762903-184762925 CCACCGGGCCTTTCTTTGCAGGC 0: 1
1: 0
2: 0
3: 11
4: 133
Right 984920850 4:184762927-184762949 CTCCAGCCCAAATCCCTATGAGG 0: 1
1: 0
2: 1
3: 6
4: 155
984920848_984920850 -2 Left 984920848 4:184762906-184762928 CCGGGCCTTTCTTTGCAGGCTCT 0: 1
1: 0
2: 0
3: 31
4: 316
Right 984920850 4:184762927-184762949 CTCCAGCCCAAATCCCTATGAGG 0: 1
1: 0
2: 1
3: 6
4: 155
984920841_984920850 22 Left 984920841 4:184762882-184762904 CCTTCGTCCCAGGAACTGAGGCC 0: 1
1: 0
2: 1
3: 6
4: 167
Right 984920850 4:184762927-184762949 CTCCAGCCCAAATCCCTATGAGG 0: 1
1: 0
2: 1
3: 6
4: 155
984920849_984920850 -7 Left 984920849 4:184762911-184762933 CCTTTCTTTGCAGGCTCTCCAGC 0: 1
1: 0
2: 3
3: 35
4: 314
Right 984920850 4:184762927-184762949 CTCCAGCCCAAATCCCTATGAGG 0: 1
1: 0
2: 1
3: 6
4: 155
984920845_984920850 14 Left 984920845 4:184762890-184762912 CCAGGAACTGAGGCCACCGGGCC 0: 1
1: 1
2: 0
3: 20
4: 177
Right 984920850 4:184762927-184762949 CTCCAGCCCAAATCCCTATGAGG 0: 1
1: 0
2: 1
3: 6
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984920850 Original CRISPR CTCCAGCCCAAATCCCTATG AGG Intronic