ID: 984920852

View in Genome Browser
Species Human (GRCh38)
Location 4:184762932-184762954
Sequence GCCCAAATCCCTATGAGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 3, 3: 11, 4: 113}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984920844_984920852 20 Left 984920844 4:184762889-184762911 CCCAGGAACTGAGGCCACCGGGC 0: 1
1: 0
2: 0
3: 20
4: 178
Right 984920852 4:184762932-184762954 GCCCAAATCCCTATGAGGCCTGG 0: 1
1: 0
2: 3
3: 11
4: 113
984920845_984920852 19 Left 984920845 4:184762890-184762912 CCAGGAACTGAGGCCACCGGGCC 0: 1
1: 1
2: 0
3: 20
4: 177
Right 984920852 4:184762932-184762954 GCCCAAATCCCTATGAGGCCTGG 0: 1
1: 0
2: 3
3: 11
4: 113
984920847_984920852 6 Left 984920847 4:184762903-184762925 CCACCGGGCCTTTCTTTGCAGGC 0: 1
1: 0
2: 0
3: 11
4: 133
Right 984920852 4:184762932-184762954 GCCCAAATCCCTATGAGGCCTGG 0: 1
1: 0
2: 3
3: 11
4: 113
984920841_984920852 27 Left 984920841 4:184762882-184762904 CCTTCGTCCCAGGAACTGAGGCC 0: 1
1: 0
2: 1
3: 6
4: 167
Right 984920852 4:184762932-184762954 GCCCAAATCCCTATGAGGCCTGG 0: 1
1: 0
2: 3
3: 11
4: 113
984920849_984920852 -2 Left 984920849 4:184762911-184762933 CCTTTCTTTGCAGGCTCTCCAGC 0: 1
1: 0
2: 3
3: 35
4: 314
Right 984920852 4:184762932-184762954 GCCCAAATCCCTATGAGGCCTGG 0: 1
1: 0
2: 3
3: 11
4: 113
984920848_984920852 3 Left 984920848 4:184762906-184762928 CCGGGCCTTTCTTTGCAGGCTCT 0: 1
1: 0
2: 0
3: 31
4: 316
Right 984920852 4:184762932-184762954 GCCCAAATCCCTATGAGGCCTGG 0: 1
1: 0
2: 3
3: 11
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984920852 Original CRISPR GCCCAAATCCCTATGAGGCC TGG Intronic