ID: 984921071

View in Genome Browser
Species Human (GRCh38)
Location 4:184765001-184765023
Sequence TCTCACTAACTCCCAAGTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 156}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984921070_984921071 6 Left 984921070 4:184764972-184764994 CCTTTACTGGAAGTGCACAAGCA 0: 1
1: 0
2: 2
3: 13
4: 129
Right 984921071 4:184765001-184765023 TCTCACTAACTCCCAAGTCATGG 0: 1
1: 0
2: 0
3: 15
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984921071 Original CRISPR TCTCACTAACTCCCAAGTCA TGG Intronic
901112381 1:6808922-6808944 CCTCACTAAATCCCCAGTTATGG - Intronic
902516854 1:16994072-16994094 CCTCCTTAACTCCCAAGTTAGGG + Intronic
902890238 1:19438072-19438094 TCCCACTACCTCCTACGTCAGGG + Intronic
903580802 1:24369156-24369178 TATCACCAACTCGAAAGTCAGGG + Intronic
904564319 1:31418861-31418883 GCTCACTACCTCCCAAGGCAAGG - Intronic
904835585 1:33333570-33333592 TCTCATTAACTCCCCTTTCAAGG + Intronic
906370837 1:45252232-45252254 TCTCACTATGTCCTAAGGCAGGG + Intronic
907656212 1:56343846-56343868 TCTCAGTAGCTCCCAAGCAATGG + Intergenic
909703644 1:78554388-78554410 TCCCACTAGCTCCCAAGTAATGG + Intergenic
912598982 1:110908371-110908393 TCACACTAGCTCCCCAGCCATGG + Intergenic
920566849 1:206980884-206980906 TCTCACCAACACCCAAGAAAGGG - Intergenic
924369000 1:243327146-243327168 TCTCAGTAGTTCCCAAGTCCTGG - Intronic
1065675742 10:28172061-28172083 TCTCACAAACTGCCAGGTCTAGG + Intronic
1066288126 10:33988403-33988425 TTTCTATAAGTCCCAAGTCACGG + Intergenic
1067493995 10:46746017-46746039 TCTCACTAGCTCCCTAGGAAAGG - Intergenic
1067600667 10:47594387-47594409 TCTCACTAGCTCCCTAGGAAAGG + Intergenic
1068238097 10:54264384-54264406 TCTCACTAGCTCCCTAGAAAAGG + Intronic
1068515044 10:58015376-58015398 TCTCACAAAATACCAAATCATGG - Intergenic
1069050395 10:63786387-63786409 TGTCACTAGCTCCTAAGGCAGGG - Intergenic
1069793266 10:71036843-71036865 TCTGTCTGACTCCCAAGTCTGGG + Intergenic
1071652200 10:87402259-87402281 TCTCACTAGCTCCCTAGGAAAGG + Intergenic
1072495921 10:95959291-95959313 TCTAACAAACTCCCAGGTGAAGG - Intronic
1078220435 11:9347254-9347276 TCTCTCTACCTCACAACTCAAGG + Intergenic
1079485805 11:20935084-20935106 TCTCAATAAATCCTAAGGCATGG + Intronic
1086094642 11:83038069-83038091 TCTCTCTAACCCTCCAGTCAAGG - Intronic
1086744826 11:90411744-90411766 CCTCCCTCACTCCCAAGTCAAGG + Intergenic
1091433404 12:454907-454929 TCTTCCCCACTCCCAAGTCATGG - Intergenic
1092053074 12:5487077-5487099 TATCACAAACTCCCATGTCATGG - Intronic
1095544386 12:43347616-43347638 CCTCCCTAAATCCCAAGTCTGGG + Intergenic
1098547872 12:71731433-71731455 TCTCCCTACCGCCCAAGACATGG - Intergenic
1100170257 12:91967745-91967767 TTTCACCAGCTCACAAGTCAAGG - Intergenic
1101124112 12:101613555-101613577 TGTCACTAATTCCCAATTCTGGG + Intronic
1104087116 12:125485558-125485580 TATCACTAATTGCCAAGTCCTGG - Intronic
1106273128 13:28173832-28173854 TCACACTAACTCAAAATTCAGGG - Intronic
1106469171 13:30039507-30039529 TAGCACTAACTCCCAAGCAATGG + Intergenic
1108022466 13:46142294-46142316 TCTCATTAGCTGCCAAATCAAGG + Exonic
1108187402 13:47901850-47901872 TCTCACAAACTTCAAAGACAGGG + Intergenic
1108691343 13:52861976-52861998 ACCCACTGACTCCCCAGTCAGGG + Intergenic
1108903099 13:55436662-55436684 CCTCACTAGTTCCCAAGTAATGG + Intergenic
1109179104 13:59191663-59191685 TCTCTCCAACTCCCAAACCATGG + Intergenic
1110165456 13:72437195-72437217 TCTCACTAAATCACAAATCCAGG + Intergenic
1110748783 13:79088438-79088460 GGTCACTAACTCCCAGGGCAAGG + Intergenic
1113926700 13:113945698-113945720 TCTGAGCTACTCCCAAGTCAAGG + Intergenic
1115266487 14:31506134-31506156 TCTCCCTGACTCCCTAGTCTAGG - Intronic
1115354227 14:32430472-32430494 TCTCTGAAACTCCTAAGTCAAGG - Intronic
1119180553 14:72602162-72602184 TTTCTCTGACTCCCAAGCCAGGG + Intergenic
1119883769 14:78123083-78123105 TCTGTCTCCCTCCCAAGTCATGG + Intergenic
1126317454 15:47385745-47385767 TGTAACTGAATCCCAAGTCAAGG + Intronic
1127417794 15:58773939-58773961 TCTAACTAACTCCCTAGTTGAGG - Intronic
1128729622 15:70012151-70012173 ACACAGTAACTGCCAAGTCAGGG - Intergenic
1130723059 15:86409099-86409121 TGTCAGTAATTCCCAAATCATGG + Intronic
1131849183 15:96519818-96519840 TCTGAAAAACTCCCAAGTCATGG + Intergenic
1137679656 16:50329392-50329414 TCTCACTGCCACCCAAGACATGG + Intronic
1137867239 16:51913052-51913074 TTTCCCTTACTCCCAAGACATGG + Intergenic
1138214171 16:55188721-55188743 GCTCACTATTTCCCAAGTTAAGG - Intergenic
1138307812 16:55994345-55994367 TCTCACTATCTCCTAAGGCTGGG + Intergenic
1138315105 16:56063041-56063063 TCTCACTAACCCCTAACTCATGG + Intergenic
1138549086 16:57737393-57737415 TCTATCTTACTCCCAAGTCTAGG - Intronic
1138661754 16:58523518-58523540 TCAGACTAAGTCCTAAGTCAAGG - Intronic
1139312478 16:66039444-66039466 TCTCCCTAACTCCCTTGTCATGG + Intergenic
1140268504 16:73441680-73441702 TGTCACTGACTCCCAGCTCAGGG - Intergenic
1141488156 16:84354804-84354826 ACTCACTGACTCAAAAGTCATGG - Intergenic
1143405809 17:6676615-6676637 TCTCACTAACTCCAGCGTCAGGG - Intergenic
1143725763 17:8844317-8844339 TCTCACAAACTCCCACGTAGGGG + Intronic
1143980166 17:10862013-10862035 TTTCATTATCTCCAAAGTCAAGG - Intergenic
1144769776 17:17753014-17753036 TCTCCCTTCCTCCCAAGTCCCGG - Intronic
1146749247 17:35362812-35362834 TCTCAGAAGCTCCCAATTCATGG - Exonic
1146757344 17:35444688-35444710 TCTCGGAAGCTCCCAAGTCATGG - Exonic
1146772008 17:35577756-35577778 ACTCAGTAACTCTTAAGTCATGG + Intronic
1146996255 17:37323518-37323540 GCTCACTAACTTCCAACTCCTGG - Intronic
1148067339 17:44881796-44881818 CCTCACTACCTCCCAGCTCAAGG + Intronic
1148237459 17:45978463-45978485 TCCCCCCAACCCCCAAGTCATGG - Intronic
1148964032 17:51419590-51419612 TCTCACTGACGCCAAAGTCAGGG + Intergenic
1149666792 17:58370647-58370669 ACTCAGGAACTCCCAAGTGATGG + Intronic
1150643288 17:66964004-66964026 TCTCCCTCAACCCCAAGTCAGGG + Intergenic
1152012813 17:77728972-77728994 GCTCACAAAATCCCAAGTGATGG + Intergenic
1152442601 17:80318139-80318161 TCTCTCTCACTACCAAGTCTGGG + Intronic
1153430738 18:5014068-5014090 TTTCTCTAATTCACAAGTCAAGG + Intergenic
932071576 2:68626060-68626082 GCTAACTCACTCCCAACTCAGGG - Intronic
932598487 2:73108697-73108719 CCTCCCTAACTCCCAAGACAGGG - Intronic
933275281 2:80277459-80277481 TCTCTCTACCTCTCAATTCATGG - Intronic
933638997 2:84739904-84739926 TCCCACTAGCTCCCAAGCAATGG - Intronic
934057149 2:88261046-88261068 TCACACAAACTCCTAACTCAAGG - Intergenic
937498578 2:122451596-122451618 TCTCACTAGCTCCCAAGCAATGG + Intergenic
937727017 2:125178768-125178790 TCTCACTACCTCCCCAGACAAGG - Intergenic
937798868 2:126058591-126058613 TCACACTAACTCACCAGCCATGG - Intergenic
941583836 2:167332047-167332069 TCTCACAAGCCCCCAAGTCTAGG - Intergenic
941985290 2:171504687-171504709 TCTCACCACCACCCAAGACACGG + Intergenic
943029715 2:182671127-182671149 TCTCATAAACTCCCAGGTGATGG + Intergenic
944101097 2:196028808-196028830 TCCCACTAACTGCCCAGTGAGGG + Intronic
946208428 2:218127944-218127966 TCTCACTACATCCCCAGTCAAGG - Intronic
946307382 2:218864031-218864053 TCTGCCTCACTCCCAAGACAGGG - Intronic
946635100 2:221716289-221716311 TTTTACAAACACCCAAGTCATGG - Intergenic
947787244 2:232834299-232834321 TCTCACAAGTTCCCAAGTGACGG - Intronic
1170894047 20:20398419-20398441 TCTCAGTAACTGCCAATCCATGG + Intronic
1170943966 20:20872940-20872962 TTTCAAAAACTCCCAAGTCCAGG + Intergenic
1171265020 20:23764242-23764264 TCTCACTATCTCCCCAGCAATGG + Intergenic
1171351429 20:24506068-24506090 TCCCACCAACTCTCAAGTCCTGG + Intronic
1171476800 20:25416187-25416209 TCTCACTTTCTACCAAGTCTGGG - Intronic
1175656535 20:60775956-60775978 TCTCCCTCAATCCCAAATCAAGG + Intergenic
1176946596 21:14989735-14989757 TTTCCCTGACTCCAAAGTCATGG + Intronic
1177856168 21:26403045-26403067 TTTCATTAAGTCCCAAATCAAGG + Intergenic
1180940220 22:19655967-19655989 TCTCAATCATTCTCAAGTCAAGG + Intergenic
1181100629 22:20536627-20536649 TCTCAGTCCCTCCCAAGGCAAGG - Intronic
1181711384 22:24694065-24694087 TCTCAATCATTCTCAAGTCAAGG - Intergenic
1182372913 22:29824814-29824836 TCTCTCTGACGCACAAGTCAAGG + Intronic
1184521739 22:44998605-44998627 TTCCACAGACTCCCAAGTCAGGG + Intronic
949461596 3:4300706-4300728 TCTCACTCACACCCACTTCAAGG - Intronic
954520269 3:51218907-51218929 TCTCACAAGCTCTCAAGTGATGG + Intronic
957842130 3:85685308-85685330 TATCACTAACTTCCAAATCTAGG + Intronic
962313306 3:134341126-134341148 GCCCTCTAAGTCCCAAGTCAAGG - Intergenic
962505992 3:136046723-136046745 TCTCACTAGCTCCCCAGCAATGG + Intronic
962900266 3:139755680-139755702 CCTCACTAACTTCCACATCAAGG - Intergenic
963806276 3:149726292-149726314 TCTGCCTAACTCCCATGGCAGGG + Intronic
966008171 3:175042878-175042900 ACTCACTAACTCCCTAGGGAGGG - Intronic
966086917 3:176079451-176079473 TCTCCCTGACTCCAAAGTCTGGG - Intergenic
967645887 3:191923113-191923135 TCACACTAGCTCCCAAGCAATGG - Intergenic
969158264 4:5232496-5232518 TTTCACTAAATTCCAAGTTAAGG + Intronic
974534189 4:63153576-63153598 TCACACTAGCTCCCAAGCAATGG - Intergenic
975276204 4:72505084-72505106 TCTCACTAACTCTCCAGCAATGG - Intronic
975745960 4:77474048-77474070 TCTCGCTAGCTCCCAAGCAACGG + Intergenic
976201712 4:82585743-82585765 TCTCACTAACTCACAATTAGGGG - Intergenic
976392087 4:84516378-84516400 ACTTACTACCTCCCAAGGCAGGG + Intergenic
980088271 4:128415225-128415247 TCCCACTAGCTCCCAAGCAATGG - Intergenic
980519204 4:133909456-133909478 TCACACTAACTCACCAGTAATGG - Intergenic
981739042 4:147983821-147983843 TCCCACTAACTCCCCAGCAATGG - Intronic
984921071 4:184765001-184765023 TCTCACTAACTCCCAAGTCATGG + Intronic
985422817 4:189801568-189801590 TCTCACTTACTCCCAGGTCTGGG - Intergenic
989015402 5:36925894-36925916 TCTCCCAAACTTCTAAGTCATGG + Intronic
992311939 5:75510835-75510857 CCGCCCTAAGTCCCAAGTCACGG + Intronic
992984988 5:82219519-82219541 TCTCACTAGCTACAAAGACAAGG - Intronic
993620524 5:90162600-90162622 TCTCACTCACTTCAAAGACAGGG + Intergenic
994680958 5:102887219-102887241 TCTCACTCACCCCCATGTGAGGG - Intronic
999619959 5:153462816-153462838 TCTCACTCCCTGCCATGTCAAGG + Intergenic
1002373532 5:178772832-178772854 TCTCTCTACCTCCCCAGTAATGG - Intergenic
1003951580 6:11121264-11121286 TCTTACTAAATCCCAGGACATGG + Intronic
1004407177 6:15343987-15344009 TCCCACTAACTCTCAGGTCCGGG - Intronic
1004747732 6:18528279-18528301 ACTCTCTAACTCTCAGGTCAGGG - Intergenic
1009042604 6:58197716-58197738 TCTCTCTGAATCACAAGTCAGGG + Intergenic
1011227929 6:85128101-85128123 TCTCACTAGCTCCAAAATCTTGG + Intergenic
1012405033 6:98886267-98886289 TCTCATTTACTCCTAAGGCAAGG - Intronic
1014358341 6:120440777-120440799 TCTAAATAACTCATAAGTCAAGG + Intergenic
1014749833 6:125243824-125243846 TCACACTAACTCCCTAGGAATGG - Intronic
1021106828 7:16646676-16646698 TCTCACTGACTCGCTAGTAATGG - Intronic
1022890355 7:34690371-34690393 TCACACTAACTCTCCAGTAATGG + Intronic
1029117394 7:98244379-98244401 TGTGACTATCTCCCAAGTGAAGG + Intronic
1030946570 7:115729486-115729508 TCACACTCACACACAAGTCAGGG - Intergenic
1034139439 7:148802339-148802361 TGTCACTCACTCCCCAGCCACGG + Intergenic
1034257537 7:149732859-149732881 TCTCACTGACTCCTAGGGCAGGG + Intronic
1039112292 8:34053018-34053040 TCACACTAGCTCCCTAGCCATGG + Intergenic
1041560671 8:59214870-59214892 TCTCACTAGCTCCCCAGCAATGG - Intergenic
1041588702 8:59550613-59550635 TCCCACTAACTACAAATTCAGGG - Intergenic
1043425044 8:80140164-80140186 CCTCACTAAGGCCCAAGTCCTGG + Intronic
1049603894 8:143520312-143520334 TCTTACTTCCTCCCAAGTCGGGG - Intronic
1050133803 9:2440877-2440899 TCACACTAGCTCCCCAGCCATGG - Intergenic
1053014002 9:34651613-34651635 TCTCATCTACTCCCCAGTCATGG - Exonic
1057830308 9:98401156-98401178 TCTCAGTCACTCTCAAGGCAAGG + Intronic
1058841986 9:108918801-108918823 TCCCACTCACTTCCAAGCCAGGG + Exonic
1059287939 9:113193192-113193214 TTACACTGACTCCCAAGTAAGGG + Intronic
1059697292 9:116741331-116741353 ACTCAATAGCTCCCAAGCCAAGG - Intronic
1060125126 9:121036667-121036689 TTTCATTAACACCCAACTCAGGG + Intronic
1186574965 X:10755574-10755596 TCTCACCACCCCCCAAGCCAGGG + Intronic
1191008413 X:55736500-55736522 TCACACTAACTCTCCAGTGATGG - Intronic
1194356746 X:92895323-92895345 TTACACTAACTCCCCAGCCATGG - Intergenic
1196702831 X:118690266-118690288 ACTCACCAACTCCCAAGACAGGG - Intergenic
1197493691 X:127152090-127152112 TCACACTAGCTCCCAAGCGATGG - Intergenic
1198090198 X:133321229-133321251 TCTCCCTACCTCCCAGGTTACGG - Intronic
1199322503 X:146456590-146456612 TCACACTAACTCCCCAGCAATGG + Intergenic
1200665080 Y:6012323-6012345 TTACACTAACTCCCCAGCCATGG - Intergenic
1200706361 Y:6446098-6446120 TTTCACTAACACCCAACTCTGGG - Intergenic
1201852267 Y:18498431-18498453 TCTTACTAAAGCCCAAATCATGG - Intergenic
1201881054 Y:18821953-18821975 TCTTACTAAAGCCCAAATCATGG + Intronic