ID: 984922891

View in Genome Browser
Species Human (GRCh38)
Location 4:184781307-184781329
Sequence TAGGGTAAAAAACCTAATCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 173}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984922888_984922891 29 Left 984922888 4:184781255-184781277 CCTACATATAAACAATATGCAAA 0: 1
1: 0
2: 5
3: 38
4: 495
Right 984922891 4:184781307-184781329 TAGGGTAAAAAACCTAATCATGG 0: 1
1: 0
2: 1
3: 13
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984922891 Original CRISPR TAGGGTAAAAAACCTAATCA TGG Intronic
906785585 1:48612831-48612853 TAGGGTTAAAAACAAAATGAGGG + Intronic
906813309 1:48851322-48851344 TTGAGTAAAAAACATAGTCAGGG + Intronic
906876932 1:49549519-49549541 TTGGGTCAAAAACAAAATCAAGG - Intronic
908940097 1:69421691-69421713 TAGGCCTAGAAACCTAATCAAGG + Intergenic
909224104 1:72994151-72994173 TAGGGAAGAAAGCCTAATTATGG + Intergenic
909267496 1:73579140-73579162 TTGGGTAAACAACAAAATCAAGG + Intergenic
909363241 1:74789836-74789858 TAGGGTAAATGACTTAACCAAGG - Intergenic
915845350 1:159258184-159258206 TAGGGGAAAAATCATATTCAAGG + Intergenic
915852082 1:159335101-159335123 TAGGGTAACATAGTTAATCATGG - Intergenic
915987553 1:160481652-160481674 TAGGGAAACAAATCTAATTATGG + Intergenic
918128588 1:181605538-181605560 AAGGGAAAAAAATCTATTCAAGG + Intronic
919776731 1:201199137-201199159 TAGGGTAAAAAGGCTTATGATGG + Intronic
924957252 1:248941362-248941384 TAGGGAAGAAAGCCTCATCATGG + Intergenic
1065163039 10:22943584-22943606 AAGGGAAAAAAAACTAATAATGG - Intronic
1071417799 10:85457445-85457467 TAGGGAAGAAAGCCTAATCGTGG + Intergenic
1071820805 10:89278739-89278761 TAGGTTAAAAAAAGTAATTATGG + Intronic
1073119359 10:101112148-101112170 TGGGGGAAAAACCCTGATCAGGG - Intronic
1074423667 10:113331713-113331735 GAGGGTAAAATAACTACTCAAGG + Intergenic
1076963159 10:133783206-133783228 TAGGGAAGAAAGCCTCATCATGG + Intergenic
1077981650 11:7307104-7307126 TAAGGTCAAAAACCTAATGTGGG - Intronic
1079966439 11:26985839-26985861 TAGGATTAAAAAGCTAATCAAGG + Intergenic
1080427193 11:32166823-32166845 GAGGCTAAAACACCAAATCAAGG + Intergenic
1080962148 11:37173066-37173088 TAGGGAAGAAAGCCTAATGATGG + Intergenic
1081019277 11:37923545-37923567 TATGGTAAAAAACATAAAGAAGG - Intergenic
1082866377 11:57903427-57903449 TATGGTAAAAAACATATTCTGGG + Intergenic
1087529781 11:99365021-99365043 TGGAATAAAAAACCTAATTAAGG + Intronic
1088570425 11:111218625-111218647 TAGGGGAGGAAACCAAATCATGG + Intergenic
1089025407 11:115264669-115264691 TAGGTTAAATAACTTACTCAAGG - Intronic
1089774067 11:120823939-120823961 GAGGATTAAAAATCTAATCAAGG + Intronic
1095932307 12:47639563-47639585 TTGGGTCAAAAACAAAATCAAGG + Intergenic
1099830083 12:87831054-87831076 CAGAGAAAAAAACCTAACCAGGG + Intergenic
1099846928 12:88038729-88038751 TAGGATATAAAACTGAATCAAGG + Intronic
1100590363 12:96022239-96022261 TAGGGACAGACACCTAATCAAGG + Exonic
1102315780 12:111886202-111886224 TTCGGTAAAAGACCAAATCAAGG + Intronic
1102552811 12:113704044-113704066 TAGGATAGAAATCCTAGTCAAGG - Intergenic
1104548824 12:129737114-129737136 TAGGTTAAGAAACCACATCATGG - Intronic
1105074412 12:133262907-133262929 TAGGGAAGAAAGCCTCATCATGG + Intergenic
1105866047 13:24460639-24460661 TAGGGTAAAATAATTAAGCAAGG - Intronic
1105999441 13:25706450-25706472 TAAGGTAAAAAAGCTAAGCTGGG - Intronic
1107069813 13:36257341-36257363 TAGGGTAATGAACCTCACCAGGG - Intronic
1107348199 13:39486014-39486036 AAGGGTAAATAACCTGCTCAGGG + Intronic
1109013329 13:56976869-56976891 TAGGCTTTAAAACCTAATCAAGG + Intergenic
1109047364 13:57430029-57430051 TGGGGTAAACAACAAAATCAAGG + Intergenic
1109069243 13:57742593-57742615 TTGGGTAAAAAAATTAATCGAGG - Intergenic
1111293827 13:86254822-86254844 AAGAGTAAAAAACATTATCATGG + Intergenic
1113989581 13:114350043-114350065 TAGGGAAGAAAGCCTCATCAAGG + Intergenic
1115518674 14:34211069-34211091 TAAGGTGAAAAACCTAATAAGGG - Intronic
1117116357 14:52517236-52517258 TAGGCTAAAAAATGTAATCCAGG + Intronic
1120574977 14:86170551-86170573 TAAGGGAAAAAACATAATTATGG + Intergenic
1124380971 15:29165074-29165096 TTGGGTCAAAAACGAAATCAAGG + Intronic
1124574975 15:30899858-30899880 TGGGGTACAAAACCAAATCAAGG - Intergenic
1124848563 15:33314066-33314088 TAGGGAACAAGACCTAAACAAGG + Intronic
1126536385 15:49769986-49770008 TAGGGAAAAATACATAATGAGGG + Intergenic
1127017962 15:54709669-54709691 TAAGGTAAAAAACTTAGTCAAGG - Intergenic
1133455608 16:5939955-5939977 GAGGGTAAATAACCTGACCAGGG - Intergenic
1135124918 16:19800907-19800929 AAGAGTAAAAAACATTATCATGG - Intronic
1148518314 17:48243320-48243342 GGGGGTAAAATACCCAATCATGG - Intronic
1149307155 17:55358957-55358979 AAGGGAAAAAAATCTAAGCAGGG + Intergenic
1151780452 17:76241548-76241570 TAGCTTTACAAACCTAATCAAGG - Intergenic
1152952301 17:83245433-83245455 TAGGGAAGAAAGCCTCATCATGG + Intergenic
1153672104 18:7421153-7421175 AAAGGTAACAAACCTAAGCAAGG - Intergenic
1155684952 18:28537227-28537249 TACGGACACAAACCTAATCATGG + Intergenic
1158172886 18:54619047-54619069 TAGCTTAATAAACCAAATCAGGG - Intergenic
1159061828 18:63522191-63522213 GAGGCTAGAAAACCGAATCAAGG + Intergenic
1160653843 19:250053-250075 TAGGGAAGAAAGCCTCATCATGG - Intergenic
1164098505 19:22033429-22033451 TAGGGTCAAAGATATAATCATGG - Intergenic
1164234154 19:23317441-23317463 TAGGGTAAAAATTATAAACATGG + Intronic
1164248940 19:23459977-23459999 TAGGGTAAAAATTATAACCATGG + Intergenic
1164303086 19:23979201-23979223 TAGGGTAAAAATTATAACCATGG - Intergenic
1168728289 19:58603656-58603678 TAGGGAAGAAAGCCTCATCATGG + Intergenic
926399453 2:12481769-12481791 TGGGTTAAATAACCTACTCAAGG + Intergenic
928613761 2:33016395-33016417 TAGGAACAAAAACCTAATCCAGG - Intronic
931069954 2:58635261-58635283 TAGAGTAGAAAACTTGATCAAGG - Intergenic
931739575 2:65229369-65229391 TTGTGTAACAAATCTAATCAAGG - Intronic
931873833 2:66490622-66490644 TGGGGGAAAAAACCTATGCATGG - Intronic
932010339 2:67971252-67971274 TAGGAGAAAAAAACAAATCAAGG + Intergenic
934744804 2:96752223-96752245 TAGCGTTAAAAGCCCAATCAGGG - Intergenic
936570263 2:113607354-113607376 TAGGGAAGAAAGCCTCATCATGG - Intergenic
936626298 2:114152981-114153003 TAGGGAAGAAAACCTAATCATGG + Intergenic
937736304 2:125295072-125295094 TAGAGGAAAAAATCTAATCATGG - Intergenic
937754476 2:125519122-125519144 TTGGGTAAAAAACAAAATTAAGG + Intergenic
940940940 2:159559595-159559617 TAGGATAAAAAAACTAGTAAAGG + Intronic
941587318 2:167377078-167377100 TTGGGTAAACAACAAAATCAAGG - Intergenic
943447517 2:188006272-188006294 TAGGGTTTAAAAACTAATAAAGG - Intergenic
949088551 2:242179297-242179319 TAGGGAAGAAAGCCTCATCATGG + Intergenic
1169792290 20:9424259-9424281 TAGGGAAAAAAACATAAATAAGG + Intronic
1170911683 20:20577548-20577570 GAGTGCAAAAAACCTAATTATGG + Intronic
1170973569 20:21139899-21139921 TAGCGTAAAAGACCAAATCATGG + Intronic
1172086850 20:32391961-32391983 TAGGGAAAAAAAAAAAATCAAGG - Intronic
1175143272 20:56876342-56876364 TAGGGTAAAAAAAAAAATCATGG - Intergenic
1175535916 20:59712145-59712167 TAGGGAAAAAAACTGATTCAGGG - Intronic
1176277771 20:64282923-64282945 TAGGGAAGAAAGCCTCATCATGG + Intronic
1177267518 21:18803915-18803937 TAGGGAGAAAAACCTACTCATGG + Intergenic
1180263714 21:46695258-46695280 TAGGGAAGAAAGCCTCATCATGG + Intergenic
1180955981 22:19741546-19741568 TAGAGAAAAAAACCCTATCATGG - Intergenic
1181794870 22:25299838-25299860 CAGGATAAACAAACTAATCAAGG - Intergenic
1181835437 22:25603487-25603509 CAGGATAAACAAACTAATCAAGG - Intronic
1182740366 22:32563022-32563044 TAGGGTATAAAAGTAAATCAAGG + Intronic
1182795605 22:32989532-32989554 TAGGGTAAATAAAGTCATCAGGG + Intronic
1182888438 22:33796161-33796183 AAGTTTAAATAACCTAATCAAGG + Intronic
1185429944 22:50803618-50803640 TAGGGAAGAAAGCCTCATCATGG + Intergenic
949829308 3:8197145-8197167 TAGGGTAACAAGCCAAATCCTGG - Intergenic
951707882 3:25562015-25562037 TAGGGTAAAAAAGTTGAGCAGGG - Intronic
953010615 3:39021957-39021979 GAGGGAAGAAAGCCTAATCATGG - Intergenic
955664140 3:61332454-61332476 TAGGAAAGAAAACCTAATCATGG + Intergenic
959533477 3:107459658-107459680 TAGGGTCATACACCTAATAAGGG + Intergenic
959582391 3:107994855-107994877 AAGGATTAAAAACCTATTCAAGG + Intergenic
960167961 3:114425470-114425492 TAGGGTAAAAAAGCAAAAAAGGG - Intronic
962293759 3:134161296-134161318 GAGGTTAAAAAACCTACTCTAGG - Intronic
963150194 3:142037729-142037751 TGGGGAAAGAAACATAATCATGG + Intronic
965046233 3:163581622-163581644 TAGAGTAAAAAAACCAATCAAGG - Intergenic
965720605 3:171656980-171657002 TAGGATTAAAAACCCATTCAGGG - Intronic
965904530 3:173687129-173687151 TAAGGTAAACAACCTGATCGTGG - Intronic
965953847 3:174344308-174344330 TAGGGTTAAAAACATACTGATGG + Intergenic
966331751 3:178822419-178822441 TGGGGTGAAAAACTTAATGATGG - Intronic
966899310 3:184468850-184468872 TGGGTTAAAGAACCTATTCAGGG + Intronic
967758768 3:193200421-193200443 TAGGGTAAATAACAAAATTAAGG - Intergenic
969199390 4:5590471-5590493 CAGGGAAGAAAACCTAATGATGG - Intronic
970184472 4:13435128-13435150 TTGGGTAAAAAACAAAATTAAGG + Intronic
970363116 4:15330044-15330066 TTGGGTAAATAACCTAAGAATGG + Intergenic
974856904 4:67471771-67471793 TAAGCTAAAAATTCTAATCAAGG - Intergenic
975154979 4:71060986-71061008 TATTGTAAACAAACTAATCAAGG + Intergenic
978223300 4:106303681-106303703 TAGGGAAGAAAGCCTAATCATGG - Intronic
978584046 4:110258982-110259004 CAGGATAAAATACCTAGTCAAGG - Intergenic
979707007 4:123732456-123732478 TTGGGTAAAAAACAAAATTAAGG - Intergenic
980336793 4:131485264-131485286 TAAGCTCAAAAACCTAACCATGG + Intergenic
984177603 4:176438390-176438412 AAGGTTAAAAAACCTATTTATGG - Intergenic
984293627 4:177826822-177826844 TAGGGAAGAAAGCCTAATCATGG - Intronic
984652393 4:182284571-182284593 TAGGGTATACAAAATAATCAGGG - Intronic
984922891 4:184781307-184781329 TAGGGTAAAAAACCTAATCATGG + Intronic
985466380 4:190200504-190200526 TAGGGAAGAAAGCCTCATCATGG + Intergenic
992604162 5:78438454-78438476 TGGGGTAAAAAACGAAATGAAGG - Intronic
995108072 5:108398235-108398257 AAGGGTAAAGAGCCAAATCAAGG + Intergenic
995434583 5:112120922-112120944 TGGGGTATAAAACCTAGTGAGGG + Intergenic
997604174 5:135162221-135162243 GAGGGTAAAAAACGTACCCATGG - Intronic
997658338 5:135571833-135571855 TAGGGTGAAAAACCTCAGAAGGG - Exonic
998439120 5:142141474-142141496 TAGAGTAAAAAATATAATCCAGG - Intronic
999477476 5:151914060-151914082 TAGTGTAAAAAACAAAATAAAGG + Intronic
1002746331 5:181476835-181476857 TAGGGAAGAAAGCCTCATCATGG + Intergenic
1002913507 6:1509839-1509861 TGGGGTAAAAGACATACTCAAGG - Intergenic
1003218205 6:4134941-4134963 TAGGGAACAAAACCGAAACACGG - Intronic
1005024276 6:21447890-21447912 TAGATTATAAAAACTAATCATGG + Intergenic
1007200403 6:40103255-40103277 CAGGGAAAAAAACCAAATCCAGG - Intergenic
1012267339 6:97161719-97161741 GAGGTTAACAAATCTAATCAAGG + Intronic
1014251905 6:119123571-119123593 TAGGGAAGAAAGCCCAATCATGG + Intronic
1015709619 6:136125671-136125693 TATGGTAAAAACCCTACTAAAGG + Intronic
1017693185 6:156987792-156987814 AAGGGTAAATAACATAAACAAGG - Intronic
1019235207 6:170606142-170606164 TAGGGAAGAAAGCCTCATCATGG + Intergenic
1020361933 7:7336134-7336156 TATGGAAAGAAACCTAACCAGGG - Intergenic
1020563278 7:9759408-9759430 TATGATAACATACCTAATCAAGG + Intergenic
1020563428 7:9761706-9761728 TAGGGTAAAGCACCCAAGCACGG - Intergenic
1020607134 7:10353708-10353730 TTGGGTAAACAATATAATCAAGG - Intergenic
1023802924 7:43850593-43850615 TAGGGGAAAAAGCCTAATTGTGG + Intergenic
1025977764 7:66382606-66382628 GAGGGTAAAAAAACAAATTAGGG + Intronic
1026361647 7:69606637-69606659 TAGGATAAAGAACCTAGTAATGG + Intronic
1027203399 7:76077474-76077496 GAGGGTAAAAAAACAAATTAGGG + Intergenic
1030431913 7:109459510-109459532 GAGAGTAAAATACTTAATCATGG + Intergenic
1030499177 7:110338047-110338069 TAGTGTGGAAAACGTAATCATGG - Intergenic
1030577149 7:111302611-111302633 GAGGTTAAATAACCAAATCAAGG + Intronic
1032584638 7:133134933-133134955 TAGAGTAAAAAGGATAATCAGGG - Intergenic
1033262641 7:139856957-139856979 TAGGGGAGAAAGCATAATCATGG + Intronic
1033576145 7:142686718-142686740 TAGGGAAGCAAACCTCATCATGG - Intergenic
1035496704 7:159333930-159333952 TAGGGAAGAAAGCCTCATCATGG + Intergenic
1035513374 8:209843-209865 TAGGGAAGAAAGCCTCATCATGG - Intergenic
1037134966 8:15449581-15449603 TAGGGGAAAAAGCCTAATGGAGG + Intronic
1040844460 8:51822361-51822383 GAGGGAAAAAAAAATAATCAAGG + Intronic
1041928911 8:63266423-63266445 TAGGGTAGCAAACCCAGTCAAGG - Intergenic
1042255361 8:66797352-66797374 GAGGGCAAAAAACCTAGCCAAGG - Intronic
1043359823 8:79459224-79459246 TTGGGTAAATTACATAATCACGG - Intergenic
1044172283 8:89069746-89069768 TTGGGTAAAAAACAAAATTAAGG - Intergenic
1044645042 8:94431546-94431568 TAGGGTAACAAAGCTATTTATGG - Intronic
1046184971 8:110701173-110701195 GTGTGTAAAAAACATAATCAAGG + Intergenic
1046345731 8:112924100-112924122 GAGGGTCAAAATCCTTATCATGG - Intronic
1047831155 8:128631449-128631471 TATGATAAAAGACCTACTCAGGG + Intergenic
1048166073 8:132062498-132062520 AAGGGTAAAAAAAATACTCATGG + Intronic
1051067188 9:13118619-13118641 TAGGTTAAAAAAACAAAACAAGG + Intronic
1053263619 9:36694058-36694080 TTGGGTCAAATAGCTAATCATGG - Intergenic
1054769851 9:69073522-69073544 TAGCGTAACAAACAAAATCATGG + Exonic
1055194710 9:73575067-73575089 TGGGGTAAAAAACACATTCATGG + Intergenic
1058513776 9:105748856-105748878 TAGGGAACAATACTTAATCATGG - Intronic
1187218957 X:17305345-17305367 TTGGGTCAAAAACTAAATCAAGG - Intergenic
1188871505 X:35378986-35379008 TTGGGTAAAGAACAAAATCAAGG - Intergenic
1189557424 X:42160020-42160042 TAGGGTAAATAATTAAATCAAGG - Intergenic
1191904357 X:66073306-66073328 TGGGGGAAAAAACCCCATCAAGG + Intergenic
1193784397 X:85741799-85741821 TAGGGTAAATAACAAAATTAAGG + Intergenic
1198668465 X:139051344-139051366 TAGGATACACAACCTGATCAAGG - Intronic
1199293016 X:146125994-146126016 TGGGGAAAAAAACCTAAGAAAGG - Intergenic
1200773043 Y:7144882-7144904 TAGGGTAAAAAAACTGGTTAGGG - Intergenic