ID: 984925321

View in Genome Browser
Species Human (GRCh38)
Location 4:184801361-184801383
Sequence ATGGGGGTGCAGAATGAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984925311_984925321 27 Left 984925311 4:184801311-184801333 CCGTGTAAACTTTATTGGACAAG 0: 1
1: 0
2: 1
3: 11
4: 116
Right 984925321 4:184801361-184801383 ATGGGGGTGCAGAATGAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984925321 Original CRISPR ATGGGGGTGCAGAATGAGGG TGG Intronic
No off target data available for this crispr