ID: 984928172

View in Genome Browser
Species Human (GRCh38)
Location 4:184825312-184825334
Sequence GTGGCCCTTGCACTTGGCCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 102}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984928172_984928176 -9 Left 984928172 4:184825312-184825334 CCACGGCCAAGTGCAAGGGCCAC 0: 1
1: 0
2: 0
3: 9
4: 102
Right 984928176 4:184825326-184825348 AAGGGCCACGGGCACTCCTCTGG 0: 1
1: 0
2: 1
3: 10
4: 104
984928172_984928179 18 Left 984928172 4:184825312-184825334 CCACGGCCAAGTGCAAGGGCCAC 0: 1
1: 0
2: 0
3: 9
4: 102
Right 984928179 4:184825353-184825375 ACCGAGAGAATGTCTGCCTCTGG 0: 1
1: 0
2: 0
3: 7
4: 107
984928172_984928181 24 Left 984928172 4:184825312-184825334 CCACGGCCAAGTGCAAGGGCCAC 0: 1
1: 0
2: 0
3: 9
4: 102
Right 984928181 4:184825359-184825381 AGAATGTCTGCCTCTGGCAGCGG 0: 1
1: 0
2: 4
3: 34
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984928172 Original CRISPR GTGGCCCTTGCACTTGGCCG TGG (reversed) Intronic
904289524 1:29475263-29475285 GTGGGCCTGGCACCTGGCAGTGG + Intergenic
914682538 1:149949027-149949049 GCTGCCCTTGCACTTTGCTGTGG - Exonic
915944484 1:160140004-160140026 GTGGGGCTTGCACTTTGCTGGGG - Intronic
916541447 1:165759258-165759280 GTGGCTTTTGAACTTGGCTGAGG - Intronic
922183214 1:223252444-223252466 GTGGCCCTTGGAGTTAGCTGTGG - Intronic
923290479 1:232540234-232540256 GTGGACGTTGCAGTGGGCCGAGG + Intronic
1063354214 10:5382727-5382749 TTGGCCCTTGGACTTGCCCTGGG - Intergenic
1063417408 10:5885146-5885168 GTGGCCCTTGCACCTGGTACAGG + Intronic
1067472932 10:46549331-46549353 GTGGCCCTTGGAGCTGGCCTGGG - Exonic
1070309499 10:75262960-75262982 GTGGCCCTTACACTGGGTTGAGG - Intergenic
1071524599 10:86351129-86351151 GTGGCGCTTGCAGCTGGCCCAGG - Intronic
1076786675 10:132753159-132753181 GGTGCCCTCGCACTTGCCCGAGG + Intronic
1079805128 11:24921434-24921456 GTGGCCATTACACTTGGCACAGG + Intronic
1081738691 11:45423197-45423219 GTGGCCCTGGCCCTTGGTGGGGG + Intergenic
1082098895 11:48155284-48155306 GTGCCCCTTCCACTAGGACGGGG - Intronic
1084310331 11:68312865-68312887 GGCGCCCGCGCACTTGGCCGCGG - Intronic
1086291297 11:85312999-85313021 GTCTCCCTTGCATTTGGCTGTGG + Intronic
1087371804 11:97293783-97293805 GAGGCACTTGCACTTTGCAGAGG - Intergenic
1089537339 11:119168885-119168907 GCGGCCCTGGCACCTGGCAGCGG - Exonic
1090953711 11:131496497-131496519 GTGGCCTTTACATTTGGCTGCGG - Intronic
1091772847 12:3164534-3164556 CTGGCCCTTGCACTTGTCCCAGG + Intronic
1094835893 12:34321902-34321924 GTAGCCCTTGCACGTGGCCCCGG - Intergenic
1107409532 13:40145556-40145578 GAGGCCCTTGCAGTTGGTTGAGG - Intergenic
1114728760 14:24967902-24967924 GTGGCAGTTGCACATGGCCATGG + Intronic
1121052590 14:90829212-90829234 GAGACCCTGGCACTTGGCCTGGG + Intergenic
1122812441 14:104295733-104295755 GCGGCGCGTGCACTTGGCCAGGG + Intergenic
1132605322 16:791285-791307 GTGGCTCTTCCACTTGCCTGGGG - Exonic
1136541047 16:30927848-30927870 GGGGCCCTTGCGCCTGGGCGGGG - Exonic
1141802155 16:86317397-86317419 CTGCCCTTTGCACTTGGCCGTGG - Intergenic
1141851142 16:86646827-86646849 GTTGCCATTCCCCTTGGCCGTGG + Intergenic
1142287949 16:89179079-89179101 GTGGCCCATGCACTCGCCAGGGG + Intronic
1142849631 17:2698081-2698103 GATGCCCTTGCACTCGACCGAGG + Exonic
1143362689 17:6384553-6384575 GTGCCCCATGCACTTTGCCAGGG + Intergenic
1143853863 17:9834077-9834099 ATGGCCTCTACACTTGGCCGGGG + Intronic
1146596204 17:34171381-34171403 GGGGCAATTGCACTTGGCCTTGG - Intronic
1147896587 17:43755474-43755496 GAGGCGCTTGCACTTGCACGAGG + Exonic
1152085403 17:78214667-78214689 CTGTCCCTTGCAGATGGCCGAGG + Exonic
1161736100 19:5992928-5992950 GTGCCCCCTGCACTTGCCTGCGG - Intergenic
1162923694 19:13918984-13919006 GTCCCCCTTGCTCTTGGCCTGGG - Exonic
1163677545 19:18662881-18662903 GCGTCCCTTCCACTTGGCAGGGG + Intronic
1164623041 19:29708760-29708782 GTGGCCTTTGCACTGGCCCGGGG + Intronic
1165386491 19:35513345-35513367 GAGGCCCTTGGACATGGCCTGGG - Exonic
1167418816 19:49390877-49390899 GTGGCCCATGGACCTGCCCGAGG + Exonic
927709236 2:25314746-25314768 GTGGCCTGTGGCCTTGGCCGTGG - Intronic
930159486 2:48139529-48139551 GCTGCCTTTGCAGTTGGCCGTGG - Intergenic
932385889 2:71332162-71332184 GACGCCGTTGCACTGGGCCGAGG + Intronic
939626274 2:144481317-144481339 GTGGCCCGAGCACATGGCCCGGG + Intronic
947915241 2:233828332-233828354 GTGGCTCTTGCATTTGGCAGTGG + Intronic
948057029 2:235016176-235016198 GTGGCCACTGCACTGGGCCCAGG + Intronic
948605043 2:239129577-239129599 GTTGCCCTTGCACTGGGCACAGG - Intronic
1169916817 20:10691502-10691524 GTGTCCCTAACACTTGGCCATGG + Intergenic
1171411029 20:24949233-24949255 GTGGCCCTGGCACCTGCCCCTGG + Exonic
1171810385 20:29741876-29741898 GTGGCCTTTGCCCTGGGCTGTGG - Intergenic
1172904495 20:38358744-38358766 GTGACCCCTGCACTAGGCCAGGG + Intronic
1174136420 20:48383071-48383093 GTGTCTCTTGCAGTTGGCAGAGG - Intergenic
1174318421 20:49721003-49721025 GTGGCCTCTCCACTTGGCCTGGG - Intergenic
1174538253 20:51269477-51269499 GTGTCCACTGCACTTGGCCATGG + Intergenic
1177496694 21:21900541-21900563 CTGGCCATTGCACTCGGCCCAGG - Intergenic
1179007744 21:37529920-37529942 TGGGCCCTTGCCCTTGGCCATGG - Intergenic
1179507049 21:41848124-41848146 GTGGCCCCTGGAGTTTGCCGTGG - Intronic
1180917533 22:19499458-19499480 GTGGCCCTTGCAGTAGGTGGGGG + Intronic
1181811268 22:25405120-25405142 GGCGCCCGTGCACTTGGTCGCGG + Intronic
1184061816 22:42087732-42087754 GTGGACCTTGCAGTGAGCCGAGG + Intronic
1184899924 22:47439568-47439590 GTAGCCCTTGCGCTTGGCCCTGG - Intergenic
950122782 3:10492857-10492879 ATGGAACTTGAACTTGGCCGAGG + Intronic
953927320 3:46989109-46989131 GGGGCACTAGCACTTGGCCCCGG - Exonic
956069228 3:65430023-65430045 GTGGACCTTGAACTCTGCCGAGG - Exonic
956871226 3:73420261-73420283 GTTCCCCTTGCACTTGGCACTGG + Intronic
966726710 3:183115239-183115261 GTGGCCCTGGCAGATGGCAGAGG - Intronic
966915899 3:184583895-184583917 GTGGCCCTTGGACTAGGCGCCGG + Intronic
968452627 4:682402-682424 GTGGCCCCTGGGCTTGGCTGTGG - Intronic
968914587 4:3491892-3491914 ACGGCTCCTGCACTTGGCCGTGG - Intronic
969680540 4:8640892-8640914 GTGGCCCTGCCCTTTGGCCGTGG + Intergenic
972688049 4:41369876-41369898 TTGGCACTTGGACTTGGCTGTGG + Intronic
975583571 4:75928701-75928723 GTGGCCCTTGCTCTGTGCCAGGG + Intronic
982203472 4:152979888-152979910 GTGGGCCTTGCCCCAGGCCGTGG + Intergenic
984928172 4:184825312-184825334 GTGGCCCTTGCACTTGGCCGTGG - Intronic
992399313 5:76397166-76397188 TTGGCTTTTGCACTTGGCCAGGG + Intergenic
995513538 5:112931441-112931463 GGGTCCCTTTCACTTGGCCAAGG - Intergenic
999653826 5:153793700-153793722 TTGGCCCTTGCAGATGGCCCTGG + Intronic
1001083107 5:168681303-168681325 GTGGCCCCTGCACCTAGCCCAGG + Intronic
1015224476 6:130841293-130841315 GTGGCTCTTGCACTCTGCCCTGG - Intronic
1015698963 6:136013559-136013581 GAGGCCGTTGAACTTGGCCTTGG + Intronic
1015999562 6:139029182-139029204 GTCGGCTTTGCACTTGGCGGTGG + Intronic
1018610184 6:165640994-165641016 GTGACCTCAGCACTTGGCCGTGG + Intronic
1019619670 7:1985432-1985454 GAGGCCCTCGCTCTTGGCCATGG - Intronic
1020280215 7:6646502-6646524 GTGGCCTGTGCACCTGGCTGGGG + Intronic
1021938377 7:25653919-25653941 GTGGCCCTTCCAGTGGGCCAAGG - Intergenic
1022955724 7:35378306-35378328 GTGGACTTTGCACTTTGCCATGG + Intergenic
1028870056 7:95760877-95760899 GTGGCCTTTGCACTAGGTTGGGG - Intergenic
1029527597 7:101104501-101104523 GGGGCTCCTGCACTTGGCCAGGG + Intergenic
1034268570 7:149792606-149792628 GGGGCCCAGGCACTTGGCCCAGG - Intergenic
1037775976 8:21835918-21835940 CTGCCCCTTGCCATTGGCCGGGG - Intergenic
1042461904 8:69079711-69079733 GTAGCCCTTGTACTTGGCTTTGG - Intergenic
1048222217 8:132552469-132552491 GTGGCCTTTGCTCTGGGCTGTGG - Intergenic
1049771956 8:144387007-144387029 TAGGCCCCTGCACTTGGCCCAGG - Intronic
1051616315 9:19010283-19010305 GTGGCCCTGGCACATGGTCATGG + Intronic
1056937163 9:90924726-90924748 GAGGGCCTGGCACTTGGCAGAGG - Intergenic
1061009917 9:127948755-127948777 GTGGTCCTTACACAGGGCCGGGG - Intronic
1061272077 9:129549468-129549490 CTGGGCCTTGCACTGGGCCCTGG - Intergenic
1062375112 9:136258549-136258571 CTGAACCTTACACTTGGCCGGGG - Intergenic
1189271496 X:39755264-39755286 GTGTCCCCTGCACCAGGCCGAGG - Intergenic
1190116603 X:47629613-47629635 GAGGCCCTTGCACTTGCCGGAGG + Exonic
1190595226 X:52046388-52046410 GTGTCCCTTACACATGGACGGGG + Intergenic
1190613598 X:52207685-52207707 GTGTCCCTTACACATGGACGGGG - Intergenic
1191253940 X:58271794-58271816 GTGGCTCTTGCACTTGACCTGGG - Intergenic
1195819740 X:108931031-108931053 GGGGGCCTTGGACTTGGCCCAGG - Intergenic
1197353151 X:125401882-125401904 GTGGCCCTTGCACTATGTAGAGG + Intergenic
1200100883 X:153688663-153688685 GGGGCCGTCGCCCTTGGCCGGGG - Exonic
1200115217 X:153766996-153767018 TTGGCACTGGCACCTGGCCGAGG + Exonic
1200119713 X:153784544-153784566 GTGGCCCCTGCCCTTGGCCATGG - Intronic
1201351176 Y:13042726-13042748 GTGTCCCTTTCACTCGGCAGGGG - Intergenic