ID: 984928328

View in Genome Browser
Species Human (GRCh38)
Location 4:184825872-184825894
Sequence AGCCGCGCCTGCTCCCGCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 157}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984928328_984928339 29 Left 984928328 4:184825872-184825894 CCGCCGCGGGAGCAGGCGCGGCT 0: 1
1: 0
2: 2
3: 16
4: 157
Right 984928339 4:184825924-184825946 TGGACCGGCCGCTCCGCCGCCGG 0: 1
1: 0
2: 1
3: 6
4: 57
984928328_984928335 14 Left 984928328 4:184825872-184825894 CCGCCGCGGGAGCAGGCGCGGCT 0: 1
1: 0
2: 2
3: 16
4: 157
Right 984928335 4:184825909-184825931 CACTCACCTCCTCCGTGGACCGG 0: 1
1: 0
2: 2
3: 27
4: 271
984928328_984928334 9 Left 984928328 4:184825872-184825894 CCGCCGCGGGAGCAGGCGCGGCT 0: 1
1: 0
2: 2
3: 16
4: 157
Right 984928334 4:184825904-184825926 GGGCGCACTCACCTCCTCCGTGG 0: 1
1: 0
2: 1
3: 10
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984928328 Original CRISPR AGCCGCGCCTGCTCCCGCGG CGG (reversed) Intronic