ID: 984928334

View in Genome Browser
Species Human (GRCh38)
Location 4:184825904-184825926
Sequence GGGCGCACTCACCTCCTCCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 101}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984928321_984928334 23 Left 984928321 4:184825858-184825880 CCGGGGCCCGGGCACCGCCGCGG 0: 1
1: 0
2: 6
3: 57
4: 420
Right 984928334 4:184825904-184825926 GGGCGCACTCACCTCCTCCGTGG 0: 1
1: 0
2: 1
3: 10
4: 101
984928325_984928334 16 Left 984928325 4:184825865-184825887 CCGGGCACCGCCGCGGGAGCAGG 0: 1
1: 0
2: 2
3: 30
4: 235
Right 984928334 4:184825904-184825926 GGGCGCACTCACCTCCTCCGTGG 0: 1
1: 0
2: 1
3: 10
4: 101
984928324_984928334 17 Left 984928324 4:184825864-184825886 CCCGGGCACCGCCGCGGGAGCAG 0: 1
1: 0
2: 1
3: 14
4: 160
Right 984928334 4:184825904-184825926 GGGCGCACTCACCTCCTCCGTGG 0: 1
1: 0
2: 1
3: 10
4: 101
984928328_984928334 9 Left 984928328 4:184825872-184825894 CCGCCGCGGGAGCAGGCGCGGCT 0: 1
1: 0
2: 2
3: 16
4: 157
Right 984928334 4:184825904-184825926 GGGCGCACTCACCTCCTCCGTGG 0: 1
1: 0
2: 1
3: 10
4: 101
984928329_984928334 6 Left 984928329 4:184825875-184825897 CCGCGGGAGCAGGCGCGGCTCCG 0: 1
1: 0
2: 0
3: 11
4: 137
Right 984928334 4:184825904-184825926 GGGCGCACTCACCTCCTCCGTGG 0: 1
1: 0
2: 1
3: 10
4: 101
984928320_984928334 29 Left 984928320 4:184825852-184825874 CCTCGGCCGGGGCCCGGGCACCG No data
Right 984928334 4:184825904-184825926 GGGCGCACTCACCTCCTCCGTGG 0: 1
1: 0
2: 1
3: 10
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984928334 Original CRISPR GGGCGCACTCACCTCCTCCG TGG Intronic