ID: 984928335

View in Genome Browser
Species Human (GRCh38)
Location 4:184825909-184825931
Sequence CACTCACCTCCTCCGTGGAC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 301
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 271}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984928328_984928335 14 Left 984928328 4:184825872-184825894 CCGCCGCGGGAGCAGGCGCGGCT 0: 1
1: 0
2: 2
3: 16
4: 157
Right 984928335 4:184825909-184825931 CACTCACCTCCTCCGTGGACCGG 0: 1
1: 0
2: 2
3: 27
4: 271
984928329_984928335 11 Left 984928329 4:184825875-184825897 CCGCGGGAGCAGGCGCGGCTCCG 0: 1
1: 0
2: 0
3: 11
4: 137
Right 984928335 4:184825909-184825931 CACTCACCTCCTCCGTGGACCGG 0: 1
1: 0
2: 2
3: 27
4: 271
984928321_984928335 28 Left 984928321 4:184825858-184825880 CCGGGGCCCGGGCACCGCCGCGG 0: 1
1: 0
2: 6
3: 57
4: 420
Right 984928335 4:184825909-184825931 CACTCACCTCCTCCGTGGACCGG 0: 1
1: 0
2: 2
3: 27
4: 271
984928324_984928335 22 Left 984928324 4:184825864-184825886 CCCGGGCACCGCCGCGGGAGCAG 0: 1
1: 0
2: 1
3: 14
4: 160
Right 984928335 4:184825909-184825931 CACTCACCTCCTCCGTGGACCGG 0: 1
1: 0
2: 2
3: 27
4: 271
984928325_984928335 21 Left 984928325 4:184825865-184825887 CCGGGCACCGCCGCGGGAGCAGG 0: 1
1: 0
2: 2
3: 30
4: 235
Right 984928335 4:184825909-184825931 CACTCACCTCCTCCGTGGACCGG 0: 1
1: 0
2: 2
3: 27
4: 271
984928333_984928335 -9 Left 984928333 4:184825895-184825917 CCGCACGGCGGGCGCACTCACCT 0: 1
1: 0
2: 0
3: 2
4: 67
Right 984928335 4:184825909-184825931 CACTCACCTCCTCCGTGGACCGG 0: 1
1: 0
2: 2
3: 27
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984928335 Original CRISPR CACTCACCTCCTCCGTGGAC CGG Intronic