ID: 984928339

View in Genome Browser
Species Human (GRCh38)
Location 4:184825924-184825946
Sequence TGGACCGGCCGCTCCGCCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 57}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984928329_984928339 26 Left 984928329 4:184825875-184825897 CCGCGGGAGCAGGCGCGGCTCCG 0: 1
1: 0
2: 0
3: 11
4: 137
Right 984928339 4:184825924-184825946 TGGACCGGCCGCTCCGCCGCCGG 0: 1
1: 0
2: 1
3: 6
4: 57
984928333_984928339 6 Left 984928333 4:184825895-184825917 CCGCACGGCGGGCGCACTCACCT 0: 1
1: 0
2: 0
3: 2
4: 67
Right 984928339 4:184825924-184825946 TGGACCGGCCGCTCCGCCGCCGG 0: 1
1: 0
2: 1
3: 6
4: 57
984928328_984928339 29 Left 984928328 4:184825872-184825894 CCGCCGCGGGAGCAGGCGCGGCT 0: 1
1: 0
2: 2
3: 16
4: 157
Right 984928339 4:184825924-184825946 TGGACCGGCCGCTCCGCCGCCGG 0: 1
1: 0
2: 1
3: 6
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984928339 Original CRISPR TGGACCGGCCGCTCCGCCGC CGG Intronic