ID: 984930950

View in Genome Browser
Species Human (GRCh38)
Location 4:184846690-184846712
Sequence ACGTGGGATTAGTGGGAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984930945_984930950 4 Left 984930945 4:184846663-184846685 CCTGGGGCTGGGAGCAAATGAAA No data
Right 984930950 4:184846690-184846712 ACGTGGGATTAGTGGGAACCAGG No data
984930944_984930950 5 Left 984930944 4:184846662-184846684 CCCTGGGGCTGGGAGCAAATGAA No data
Right 984930950 4:184846690-184846712 ACGTGGGATTAGTGGGAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984930950 Original CRISPR ACGTGGGATTAGTGGGAACC AGG Intergenic
No off target data available for this crispr