ID: 984935347

View in Genome Browser
Species Human (GRCh38)
Location 4:184884586-184884608
Sequence AGGCTGCTCACCTCCCGCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984935333_984935347 24 Left 984935333 4:184884539-184884561 CCCTTGCCCCCGTCTCCTGGCCT No data
Right 984935347 4:184884586-184884608 AGGCTGCTCACCTCCCGCTTGGG No data
984935335_984935347 18 Left 984935335 4:184884545-184884567 CCCCCGTCTCCTGGCCTTAGCCC No data
Right 984935347 4:184884586-184884608 AGGCTGCTCACCTCCCGCTTGGG No data
984935334_984935347 23 Left 984935334 4:184884540-184884562 CCTTGCCCCCGTCTCCTGGCCTT No data
Right 984935347 4:184884586-184884608 AGGCTGCTCACCTCCCGCTTGGG No data
984935345_984935347 -4 Left 984935345 4:184884567-184884589 CCTCTCATTGGCTCTCTCAAGGC No data
Right 984935347 4:184884586-184884608 AGGCTGCTCACCTCCCGCTTGGG No data
984935336_984935347 17 Left 984935336 4:184884546-184884568 CCCCGTCTCCTGGCCTTAGCCCC No data
Right 984935347 4:184884586-184884608 AGGCTGCTCACCTCCCGCTTGGG No data
984935342_984935347 -2 Left 984935342 4:184884565-184884587 CCCCTCTCATTGGCTCTCTCAAG No data
Right 984935347 4:184884586-184884608 AGGCTGCTCACCTCCCGCTTGGG No data
984935339_984935347 9 Left 984935339 4:184884554-184884576 CCTGGCCTTAGCCCCTCTCATTG No data
Right 984935347 4:184884586-184884608 AGGCTGCTCACCTCCCGCTTGGG No data
984935338_984935347 15 Left 984935338 4:184884548-184884570 CCGTCTCCTGGCCTTAGCCCCTC No data
Right 984935347 4:184884586-184884608 AGGCTGCTCACCTCCCGCTTGGG No data
984935337_984935347 16 Left 984935337 4:184884547-184884569 CCCGTCTCCTGGCCTTAGCCCCT No data
Right 984935347 4:184884586-184884608 AGGCTGCTCACCTCCCGCTTGGG No data
984935341_984935347 4 Left 984935341 4:184884559-184884581 CCTTAGCCCCTCTCATTGGCTCT No data
Right 984935347 4:184884586-184884608 AGGCTGCTCACCTCCCGCTTGGG No data
984935343_984935347 -3 Left 984935343 4:184884566-184884588 CCCTCTCATTGGCTCTCTCAAGG No data
Right 984935347 4:184884586-184884608 AGGCTGCTCACCTCCCGCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984935347 Original CRISPR AGGCTGCTCACCTCCCGCTT GGG Intergenic
No off target data available for this crispr