ID: 984938401

View in Genome Browser
Species Human (GRCh38)
Location 4:184909880-184909902
Sequence CTGAATGCAAAGAAGGAATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984938401_984938408 7 Left 984938401 4:184909880-184909902 CCTCATTCCTTCTTTGCATTCAG No data
Right 984938408 4:184909910-184909932 TGGCTCATGGCTTGTACTGGGGG 0: 5
1: 12
2: 29
3: 96
4: 306
984938401_984938413 26 Left 984938401 4:184909880-184909902 CCTCATTCCTTCTTTGCATTCAG No data
Right 984938413 4:184909929-184909951 GGGGGACCCGGTCCAAGGTTGGG No data
984938401_984938405 4 Left 984938401 4:184909880-184909902 CCTCATTCCTTCTTTGCATTCAG No data
Right 984938405 4:184909907-184909929 AACTGGCTCATGGCTTGTACTGG 0: 3
1: 10
2: 31
3: 29
4: 173
984938401_984938410 14 Left 984938401 4:184909880-184909902 CCTCATTCCTTCTTTGCATTCAG No data
Right 984938410 4:184909917-184909939 TGGCTTGTACTGGGGGGACCCGG No data
984938401_984938404 -6 Left 984938401 4:184909880-184909902 CCTCATTCCTTCTTTGCATTCAG No data
Right 984938404 4:184909897-184909919 ATTCAGATTCAACTGGCTCATGG 0: 23
1: 22
2: 8
3: 28
4: 218
984938401_984938407 6 Left 984938401 4:184909880-184909902 CCTCATTCCTTCTTTGCATTCAG No data
Right 984938407 4:184909909-184909931 CTGGCTCATGGCTTGTACTGGGG 0: 4
1: 9
2: 17
3: 100
4: 404
984938401_984938406 5 Left 984938401 4:184909880-184909902 CCTCATTCCTTCTTTGCATTCAG No data
Right 984938406 4:184909908-184909930 ACTGGCTCATGGCTTGTACTGGG 0: 3
1: 8
2: 21
3: 19
4: 215
984938401_984938409 8 Left 984938401 4:184909880-184909902 CCTCATTCCTTCTTTGCATTCAG No data
Right 984938409 4:184909911-184909933 GGCTCATGGCTTGTACTGGGGGG No data
984938401_984938412 25 Left 984938401 4:184909880-184909902 CCTCATTCCTTCTTTGCATTCAG No data
Right 984938412 4:184909928-184909950 GGGGGGACCCGGTCCAAGGTTGG No data
984938401_984938411 21 Left 984938401 4:184909880-184909902 CCTCATTCCTTCTTTGCATTCAG No data
Right 984938411 4:184909924-184909946 TACTGGGGGGACCCGGTCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984938401 Original CRISPR CTGAATGCAAAGAAGGAATG AGG (reversed) Intergenic
No off target data available for this crispr