ID: 984938774

View in Genome Browser
Species Human (GRCh38)
Location 4:184913131-184913153
Sequence TCTGATATTCAGAGGTTGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984938774_984938778 28 Left 984938774 4:184913131-184913153 CCTACCAACCTCTGAATATCAGA No data
Right 984938778 4:184913182-184913204 AGTACAGAGGCCAATTCATAAGG No data
984938774_984938777 15 Left 984938774 4:184913131-184913153 CCTACCAACCTCTGAATATCAGA No data
Right 984938777 4:184913169-184913191 TCTAAAAATCTTAAGTACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984938774 Original CRISPR TCTGATATTCAGAGGTTGGT AGG (reversed) Intergenic
No off target data available for this crispr