ID: 984940714

View in Genome Browser
Species Human (GRCh38)
Location 4:184929846-184929868
Sequence ACACATCACCAGTGGGCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984940707_984940714 26 Left 984940707 4:184929797-184929819 CCTCAGTGGCACTTTGTAGAGGT No data
Right 984940714 4:184929846-184929868 ACACATCACCAGTGGGCAGATGG No data
984940709_984940714 -9 Left 984940709 4:184929832-184929854 CCGTGTCTGCCCACACACATCAC No data
Right 984940714 4:184929846-184929868 ACACATCACCAGTGGGCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984940714 Original CRISPR ACACATCACCAGTGGGCAGA TGG Intergenic
No off target data available for this crispr