ID: 984943755

View in Genome Browser
Species Human (GRCh38)
Location 4:184955324-184955346
Sequence ATGTGTGTGTGGAGGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984943748_984943755 12 Left 984943748 4:184955289-184955311 CCACAGATGCTCAAATGCACAAG No data
Right 984943755 4:184955324-184955346 ATGTGTGTGTGGAGGGAGGAGGG No data
984943747_984943755 13 Left 984943747 4:184955288-184955310 CCCACAGATGCTCAAATGCACAA No data
Right 984943755 4:184955324-184955346 ATGTGTGTGTGGAGGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984943755 Original CRISPR ATGTGTGTGTGGAGGGAGGA GGG Intergenic
No off target data available for this crispr