ID: 984944878

View in Genome Browser
Species Human (GRCh38)
Location 4:184963025-184963047
Sequence CAGGGAAAACTGAAGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984944878_984944887 13 Left 984944878 4:184963025-184963047 CCATCCTCCTTCAGTTTTCCCTG No data
Right 984944887 4:184963061-184963083 CAATCACATAATCGGAGAGTTGG No data
984944878_984944885 5 Left 984944878 4:184963025-184963047 CCATCCTCCTTCAGTTTTCCCTG No data
Right 984944885 4:184963053-184963075 TATGGTGCCAATCACATAATCGG No data
984944878_984944891 27 Left 984944878 4:184963025-184963047 CCATCCTCCTTCAGTTTTCCCTG No data
Right 984944891 4:184963075-184963097 GAGAGTTGGGGACCCTTGCTGGG No data
984944878_984944890 26 Left 984944878 4:184963025-184963047 CCATCCTCCTTCAGTTTTCCCTG No data
Right 984944890 4:184963074-184963096 GGAGAGTTGGGGACCCTTGCTGG No data
984944878_984944889 15 Left 984944878 4:184963025-184963047 CCATCCTCCTTCAGTTTTCCCTG No data
Right 984944889 4:184963063-184963085 ATCACATAATCGGAGAGTTGGGG No data
984944878_984944888 14 Left 984944878 4:184963025-184963047 CCATCCTCCTTCAGTTTTCCCTG No data
Right 984944888 4:184963062-184963084 AATCACATAATCGGAGAGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984944878 Original CRISPR CAGGGAAAACTGAAGGAGGA TGG (reversed) Intergenic
No off target data available for this crispr