ID: 984946107

View in Genome Browser
Species Human (GRCh38)
Location 4:184969798-184969820
Sequence GTGTGAAAGGTGAAGACAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984946107_984946114 3 Left 984946107 4:184969798-184969820 CCAGTTGTCTTCACCTTTCACAC No data
Right 984946114 4:184969824-184969846 CCCTCGGGCCAGGCCTCACTGGG No data
984946107_984946119 29 Left 984946107 4:184969798-184969820 CCAGTTGTCTTCACCTTTCACAC No data
Right 984946119 4:184969850-184969872 TGACCCAAATGGTCACTAGCAGG No data
984946107_984946118 18 Left 984946107 4:184969798-184969820 CCAGTTGTCTTCACCTTTCACAC No data
Right 984946118 4:184969839-184969861 TCACTGGGTGATGACCCAAATGG No data
984946107_984946112 2 Left 984946107 4:184969798-184969820 CCAGTTGTCTTCACCTTTCACAC No data
Right 984946112 4:184969823-184969845 TCCCTCGGGCCAGGCCTCACTGG No data
984946107_984946111 -7 Left 984946107 4:184969798-184969820 CCAGTTGTCTTCACCTTTCACAC No data
Right 984946111 4:184969814-184969836 TTCACACTGTCCCTCGGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984946107 Original CRISPR GTGTGAAAGGTGAAGACAAC TGG (reversed) Intergenic
No off target data available for this crispr