ID: 984952985

View in Genome Browser
Species Human (GRCh38)
Location 4:185020189-185020211
Sequence GAGGTGCCCTGCACCCGCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 83}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984952979_984952985 12 Left 984952979 4:185020154-185020176 CCTCAAATGGGAACTTTGGCCAG 0: 1
1: 0
2: 1
3: 15
4: 123
Right 984952985 4:185020189-185020211 GAGGTGCCCTGCACCCGCTTTGG 0: 1
1: 0
2: 0
3: 4
4: 83
984952984_984952985 -7 Left 984952984 4:185020173-185020195 CCAGAAAATGTGGTGGGAGGTGC 0: 1
1: 0
2: 0
3: 9
4: 163
Right 984952985 4:185020189-185020211 GAGGTGCCCTGCACCCGCTTTGG 0: 1
1: 0
2: 0
3: 4
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984952985 Original CRISPR GAGGTGCCCTGCACCCGCTT TGG Intronic
900362593 1:2297025-2297047 GAGGTGCCAGGCACCCGCACAGG + Intronic
900501030 1:3004750-3004772 GACGTGCCCTGTGCCCGCTCCGG + Intergenic
901122349 1:6906035-6906057 CAGGAGCCCAGCACCTGCTTAGG + Intronic
901166145 1:7222927-7222949 GAGGTGCCCGGCACCCTGTGTGG + Intronic
901361300 1:8703208-8703230 GCGGTGCCCTGCGGCCGCTCAGG - Intronic
902804761 1:18854175-18854197 GAGGTGCCCTGCAGACTCTATGG + Intronic
903754663 1:25652474-25652496 GAGGCCCCCAGCACCCGCTCAGG + Intronic
905732087 1:40304366-40304388 GGGGGGCCCTGCTCCCCCTTAGG + Exonic
910232244 1:84998230-84998252 GAGTTGCCCTGCGCCCGCGTCGG + Intergenic
922697369 1:227737520-227737542 CAGGTGCCCCTCTCCCGCTTAGG - Intronic
1067065198 10:43100569-43100591 GAGGTGCCCAGCTTCCGCCTGGG + Exonic
1072025580 10:91452650-91452672 GTGATGCCCTGCACCCCCTCAGG + Intronic
1072738444 10:97895367-97895389 GTGGTGCCACGCACCCGGTTTGG - Exonic
1074400729 10:113139391-113139413 GAGGTGCCCAGCACTGGCTGTGG + Intronic
1074401466 10:113144306-113144328 GAGGTGCCCTGCAGTTCCTTTGG + Intronic
1076754679 10:132563052-132563074 GAGGTGCCATGCCCCCGCCCAGG + Intronic
1078150750 11:8757800-8757822 CAGGTGGCCTGCACCAGCTCTGG + Intronic
1080711792 11:34755431-34755453 GAGGTGCTCTGCACCAGTCTGGG - Intergenic
1083223733 11:61270377-61270399 GAGGTCCCTTGCACCTGCGTTGG - Intronic
1083970377 11:66070628-66070650 GAGGTGGCCTGGGCCAGCTTGGG - Exonic
1084317242 11:68352741-68352763 GAGGTGCTCTGCACTTGGTTGGG + Intronic
1089305718 11:117524990-117525012 GAGCTGCCCTGCACCGCCTCGGG - Exonic
1090856209 11:130611097-130611119 GAGGTGCCCTGCAGTGGCCTGGG + Intergenic
1097381936 12:58905769-58905791 AAGATGCCCTACACCGGCTTAGG + Intronic
1105741148 13:23324398-23324420 CACGTCCCCTGCACCAGCTTGGG - Exonic
1118780429 14:69004293-69004315 GAGGGGCACTGCAGCCCCTTAGG - Intergenic
1119025396 14:71148520-71148542 GGGGTGCCACGTACCCGCTTTGG - Intergenic
1121022275 14:90587537-90587559 GAGGGGGCCTGCACACACTTGGG - Intronic
1121430433 14:93882581-93882603 GTGATGCCCTGCACCATCTTGGG - Intergenic
1122297898 14:100715538-100715560 GAGGTGGCCTGCAGCCGTCTGGG - Intergenic
1124066903 15:26353417-26353439 GAGGTGCCTGAGACCCGCTTGGG + Intergenic
1138323655 16:56142062-56142084 GTGATGCCCTGCACCACCTTTGG - Intergenic
1141419723 16:83905684-83905706 GAGGTCTCCTGCAGCCACTTTGG - Intronic
1143477801 17:7212692-7212714 CAGGTGCCCAACACCAGCTTGGG + Intronic
1147140114 17:38455875-38455897 ACGGTGCCCTGCACCCCCATGGG - Intronic
1147892034 17:43724190-43724212 GACGTGACCTGCACACACTTTGG + Intergenic
1148136182 17:45293359-45293381 GGGATGCCCTGCACCCCCTCTGG - Intronic
1149304203 17:55332827-55332849 AAGGTGCACTCCACCCGCCTGGG - Intergenic
1150129136 17:62657555-62657577 GAGGGGCCCTGCACCTTCTGTGG + Intronic
1151308712 17:73280395-73280417 GAGATGCTCTGGACCCGCTGGGG + Intergenic
1152820950 17:82437384-82437406 GAGCTGCCCTGGACCCTCTGAGG - Intronic
1155358725 18:24979461-24979483 GAGGTCTCCTGCACCCCCTGTGG - Intergenic
1158068124 18:53437822-53437844 CAAGTGCCCTGCACTCGCTGAGG - Intronic
1161060223 19:2211004-2211026 CAGGTGCCCAGCAACCCCTTAGG - Intronic
1164647756 19:29872298-29872320 GGGCTGCACTGCCCCCGCTTGGG - Intergenic
1167152221 19:47716856-47716878 GAGGTGCCCGGCTCCCGCGTGGG + Exonic
1167427427 19:49436691-49436713 GTGGTGGACTGCACCTGCTTCGG - Exonic
1167438978 19:49497317-49497339 GAGGTTCCCCGCACCTCCTTGGG - Exonic
926124140 2:10261383-10261405 GTGGTGCCCTGCACCGTCTCAGG - Intergenic
928466707 2:31528980-31529002 GAAGTGCCTTGCACCTTCTTGGG - Intronic
928607071 2:32952881-32952903 AATGTGCCAGGCACCCGCTTTGG - Intronic
932364509 2:71140338-71140360 GTGATGCCCTGCACCACCTTGGG - Intronic
937645852 2:124265331-124265353 GAGGTGCCCTGCCGCCCATTTGG - Intronic
940121567 2:150273679-150273701 GTGATGCCCTGCACCAACTTGGG - Intergenic
947501510 2:230674557-230674579 GAGGCTGCCTGCACCTGCTTGGG + Intergenic
948920228 2:241062909-241062931 GAGGGGCCCTGGCCCCGCTGGGG + Intronic
949035707 2:241814893-241814915 GGGGTGCCCTGCACGTGCTGGGG + Exonic
1168816620 20:742057-742079 CAAGTGGCCTGCACCAGCTTGGG + Intergenic
1180623807 22:17180470-17180492 GAGGTGTCCTTCACCAGCTATGG + Exonic
1184250823 22:43259210-43259232 CAGGGGCCCTGCACCCCCTGGGG - Intronic
953407068 3:42664777-42664799 GAGATGCCCTCCACCAGCTCTGG - Exonic
954306198 3:49726731-49726753 GAGGGGCCCTGCACCAGCCCAGG + Exonic
960712630 3:120546163-120546185 GTGATGCCCTGCACCATCTTGGG - Intergenic
960952366 3:123007674-123007696 GTGGTACCCTGCACCACCTTGGG + Intronic
962807525 3:138938054-138938076 GTGGGGCCCTGCAGCCTCTTGGG - Intergenic
968703065 4:2065779-2065801 GAGGTGCCCGGTCCCCGCTTGGG + Exonic
976709018 4:88049342-88049364 GAATTGCCTTGCACCTGCTTTGG + Intronic
980863662 4:138529316-138529338 GAAGTTCCCTGTACCAGCTTAGG - Intergenic
984927204 4:184817519-184817541 GAGCAGCCCTGCAGCCTCTTTGG + Intronic
984952985 4:185020189-185020211 GAGGTGCCCTGCACCCGCTTTGG + Intronic
985788077 5:1910360-1910382 GAGGGGCCCTGCACCTGCCCAGG + Intergenic
988997705 5:36730339-36730361 GAGGTGCCCAGTGCCCCCTTTGG - Intergenic
993708753 5:91201078-91201100 GTGGTGACGTGCACCTGCTTTGG + Intergenic
1006134427 6:31887197-31887219 GAGGGGCCCTGATCCAGCTTGGG - Intronic
1006803602 6:36774803-36774825 GGGGTGCCCTGCACAGGCTGGGG - Intronic
1007086304 6:39148642-39148664 GAGGTTCCCTGCATCCAGTTTGG + Intergenic
1017931659 6:158960673-158960695 GTGATGCCCTGCACCACCTTGGG - Intergenic
1018064783 6:160117292-160117314 GAGGAGCCCTGCAGCTGCTCTGG + Intergenic
1024963318 7:55001328-55001350 GAGATGCCCTGCACCACCTGGGG + Intergenic
1039434949 8:37553592-37553614 GAGTTGGCCAGCACCCACTTCGG - Intergenic
1040514671 8:48125006-48125028 GAGGTGCCATGAACAAGCTTAGG + Intergenic
1050916522 9:11142282-11142304 GAGATGCCCTCCACACCCTTGGG + Intergenic
1053489680 9:38489161-38489183 GAGCGGCCCTGCACCCCCTCTGG - Intergenic
1060263071 9:122092850-122092872 CAGAGGCCCTGCACCGGCTTCGG + Exonic
1060737264 9:126073964-126073986 GTGCTGCACTGCACCCCCTTTGG - Intergenic
1061801757 9:133116627-133116649 GGGCTGCCCTGCACCCCCTTGGG - Intronic
1062280520 9:135749752-135749774 CAGGTGCCCTGCACCCACGGAGG + Intronic
1190527743 X:51345118-51345140 GTGTTGCCCTGCACCACCTTAGG + Intergenic