ID: 984955843

View in Genome Browser
Species Human (GRCh38)
Location 4:185044816-185044838
Sequence CCTCTAGTGCTGCTGGTTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984955843_984955847 18 Left 984955843 4:185044816-185044838 CCATAAACCAGCAGCACTAGAGG No data
Right 984955847 4:185044857-185044879 AGAAATATAGAGGTGTGAAGTGG 0: 274
1: 273
2: 105
3: 64
4: 355
984955843_984955849 29 Left 984955843 4:185044816-185044838 CCATAAACCAGCAGCACTAGAGG No data
Right 984955849 4:185044868-185044890 GGTGTGAAGTGGGAAATCAGAGG 0: 290
1: 251
2: 199
3: 116
4: 292
984955843_984955846 8 Left 984955843 4:185044816-185044838 CCATAAACCAGCAGCACTAGAGG No data
Right 984955846 4:185044847-185044869 ACACACACACAGAAATATAGAGG 0: 318
1: 223
2: 154
3: 536
4: 3149
984955843_984955848 19 Left 984955843 4:185044816-185044838 CCATAAACCAGCAGCACTAGAGG No data
Right 984955848 4:185044858-185044880 GAAATATAGAGGTGTGAAGTGGG 0: 286
1: 267
2: 108
3: 69
4: 231

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984955843 Original CRISPR CCTCTAGTGCTGCTGGTTTA TGG (reversed) Intergenic
No off target data available for this crispr