ID: 984956301

View in Genome Browser
Species Human (GRCh38)
Location 4:185049421-185049443
Sequence CCTGGAAAGCAGAGCCAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984956301_984956307 16 Left 984956301 4:185049421-185049443 CCCTCCTGGCTCTGCTTTCCAGG No data
Right 984956307 4:185049460-185049482 AACAATTTGAATTTCCCCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984956301 Original CRISPR CCTGGAAAGCAGAGCCAGGA GGG (reversed) Intergenic
No off target data available for this crispr