ID: 984957842

View in Genome Browser
Species Human (GRCh38)
Location 4:185063445-185063467
Sequence CTGTGTGAGTAAAAGAAACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984957842_984957846 24 Left 984957842 4:185063445-185063467 CCAAGTTTCTTTTACTCACACAG No data
Right 984957846 4:185063492-185063514 TCTAACAGAAAAAGATCCAATGG No data
984957842_984957843 1 Left 984957842 4:185063445-185063467 CCAAGTTTCTTTTACTCACACAG No data
Right 984957843 4:185063469-185063491 GCCTCATCCTAAGTGACACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984957842 Original CRISPR CTGTGTGAGTAAAAGAAACT TGG (reversed) Intergenic
No off target data available for this crispr