ID: 984958132

View in Genome Browser
Species Human (GRCh38)
Location 4:185066272-185066294
Sequence GGGTGGCTAAATGCAATCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984958130_984958132 -7 Left 984958130 4:185066256-185066278 CCAAGCTTATCCTACTGGGTGGC No data
Right 984958132 4:185066272-185066294 GGGTGGCTAAATGCAATCTGTGG No data
984958125_984958132 14 Left 984958125 4:185066235-185066257 CCTGGCTGAGAGAGCCACACACC No data
Right 984958132 4:185066272-185066294 GGGTGGCTAAATGCAATCTGTGG No data
984958126_984958132 0 Left 984958126 4:185066249-185066271 CCACACACCAAGCTTATCCTACT No data
Right 984958132 4:185066272-185066294 GGGTGGCTAAATGCAATCTGTGG No data
984958124_984958132 15 Left 984958124 4:185066234-185066256 CCCTGGCTGAGAGAGCCACACAC No data
Right 984958132 4:185066272-185066294 GGGTGGCTAAATGCAATCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984958132 Original CRISPR GGGTGGCTAAATGCAATCTG TGG Intergenic
No off target data available for this crispr