ID: 984964393

View in Genome Browser
Species Human (GRCh38)
Location 4:185127935-185127957
Sequence ACCAGGGCTTGGAAGACCCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984964388_984964393 0 Left 984964388 4:185127912-185127934 CCGGAACTCACGGTCCGGGCTGA No data
Right 984964393 4:185127935-185127957 ACCAGGGCTTGGAAGACCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984964393 Original CRISPR ACCAGGGCTTGGAAGACCCT CGG Intergenic
No off target data available for this crispr